At first I didn't like the change they made to his father in Phantom Pain but now that I think about it, it makes Otacon and Solid Snake's friendship that much more special. Both live in the shadow of the sins of their fathers and both want to escape that shadow by being better people.
@ now that I realize it most of the dads figures in this series are asses Big Boss is a hero turned war criminal Solidus fed gun powder to war orphans Campbell kidnaps a retired man , betrays him, also womanises to the point of losing his daughters trust Madnar pretty much abandoned his daughter during Metal Gear 2 and built a killing Machine just to spite the scientific community Huey Emmerich is well... Huey Emmerich Wouldn't know about the Sorrow (he's dead) Miller seems alright(Metal Gear 2 manual confirms he's a dad), though I haven't played peace walker or mgs5 so I wouldn't know much about what he's up to there Raidens alright, if a bit of an edgelord
@ I disagree. Raiden is badass too. Raiden grew up hard and unlike Otacon or Snake, he refused to acknowledge the past because he didn't want to bear it anymore of the burdens of his actions throughout his life. Any sane person would not want to.
The traits Otacon shows during this final conversation is a true testament to his character. He's happy Snake "saved the girl," even though he wasn't able to protect his. He's unlocking the security doors, choosing to believe in Snake and, by extension, us as the player. He's come to terms with his own mortality, the expendability of Shadow Moses. He's 3721893x the man his father was, that's for sure.
@@spaghettiking7312 affair with stepmother or killing your wife by locking her in AI Pod after she took your son away because she wouldn't let your son pilot a metal gear...
Takes a lot of guts to decide to stay behind even knowing you're going to be nuked into oblivion. (Yes, it later turns out that's not going to happen, but when this conversation takes place no one knows that yet)
I remember this... I remember getting the game, and playing it through... I didn't cry at the time, ut now, it sends shivers through my entire body. Love that game.
I cried uncontrollably when I first played this and it still makes me cry. Someone you love like a brother risking his life to save the people he cares about!! This Is ABSOLUTELY EMOTIONAL!!!!! especially with the music. And each note fits perfectly with what they are saying. I feel like crying right now. It's just too touching! 😢😢😢😢😢😢😢😢😢😢
thats what i was going to say... he survives both endings, thats why the "meryil dies" ending is considered a BAD ending... cuz she dies for real (and thus, non canon ending)
To remind all that skipped the codec-conversations near ending: Campbell stopped the ones that were trying to bomb Shadow Moses and sent someone who could get Otacon out of there. Thats what happens in Meryl´s ending.
Listening to this after playing all the other games, you can tell this really is David Hayter's first time doing Snake's voice because it sounds a little different from the sequels and Twin Snakes, since he was probably still trying to get the voice completely down.
Sooo, looks like that TH-cam want some heads, so I deleted most of my video. Hope this one will not get down. Thanks TH-cam, next time i'm gonna sing every songs in my videos.
Heh, been a long time since this comment and you might not even read it, but I hope you enjoyed each moment of MGS4 as much as I did back in the day, and of course, I hope it was a joyful surprise to see that what you wanted came true :)))
Does this sound like some sort of sexual innuendo to anyone except me? This "escape route" talk? The "small entrance"? He just "unlocked" it? Uh huh...
In such tragical circumstances, no innuendo was intentional. He was going to die in a nuclear, fiery death (or so he thought). I see nothing sexual about it.
The reunion must have been awkward. Here Otacon was, all prepared to make a heroic sacrifice and die to ensure Snake and Meryl survived, possibly finding some level of redemption for creating a nuclear-launching superweapon, and looking pretty cool while doing it in front of the coolest person he ever knew...only for the nukes to be called off and for him to be unceremoniously picked up by an evac chopper. I mean...damn, being alive's great and all, but it sure must have been embarrassing having gone through all that drama for nothing.
after the bombing orders get rescinded, snake tells campbell that otacon is somewhere on the base. it's most likely that a squad of soldiers were sent in to extract him.
Lets just imagine they drop the surface piercing nuke... what chances would have snake and meryl to survive and not get hit by the blast wave or die of radiation sicknes? How far away have they to be and would it be possible to be this far away? You also have consider the debris that is flying miles trough the air. I don´t know about you, but I would rather stay in the facility like otacon the end it quickly without much pain.
43rd President Of The United States, George Sears (later revealed to be Solidus Snake), found out that Secretary of Defense Jim Houseman had ordered the bombing of Shadow Moses. Sears countermanded the bombing, and forced Houseman to step down as Secretary of Defense, saving Solid Snake and Otacon.
thats wot i dnt get bout mgs 4 how meryls in it coz in mgs 2 snake n otacon seem to b a team but they never mention meryl in it so it seems that they followed up in mgs2 from the then ending of mgs1 wit otacon n snake getting out of the base, leaving meryl if thats the case then how does she get in mgs4 either way there awesome games n mgs4 just rules
At first I didn't like the change they made to his father in Phantom Pain but now that I think about it, it makes Otacon and Solid Snake's friendship that much more special. Both live in the shadow of the sins of their fathers and both want to escape that shadow by being better people.
Hal doesn't even know that Huey killed his mother and betrayed Big Boss. What he did in Phantom Pain makes no difference for Otacon.
@@sergiogonzales330 Huey almost drowned Emma when he committed suicide. Hal had to save her
@ now that I realize it most of the dads figures in this series are asses
Big Boss is a hero turned war criminal
Solidus fed gun powder to war orphans
Campbell kidnaps a retired man , betrays him, also womanises to the point of losing his daughters trust
Madnar pretty much abandoned his daughter during Metal Gear 2 and built a killing Machine just to spite the scientific community
Huey Emmerich is well... Huey Emmerich
Wouldn't know about the Sorrow (he's dead)
Miller seems alright(Metal Gear 2 manual confirms he's a dad), though I haven't played peace walker or mgs5 so I wouldn't know much about what he's up to there
Raidens alright, if a bit of an edgelord
@@oi6915 lmao
@ I disagree. Raiden is badass too. Raiden grew up hard and unlike Otacon or Snake, he refused to acknowledge the past because he didn't want to bear it anymore of the burdens of his actions throughout his life. Any sane person would not want to.
How sweet but yet sad is it that Otacon really likes that someone actually thanked him?
Imagine if Liquid was like "Oh, by the way, thanks for building REX for me!" And then he runs off laughing.
At least after MGS 4 my man Otacon became a playboy
@@PohTrainSnake taught him the art of being solid
The traits Otacon shows during this final conversation is a true testament to his character.
He's happy Snake "saved the girl," even though he wasn't able to protect his.
He's unlocking the security doors, choosing to believe in Snake and, by extension, us as the player.
He's come to terms with his own mortality, the expendability of Shadow Moses.
He's 3721893x the man his father was, that's for sure.
Yep. Other than that business with his stepmom that made Huey commit suicide. We prefer to forget that though.
@@spaghettiking7312 affair with stepmother or killing your wife by locking her in AI Pod after she took your son away because she wouldn't let your son pilot a metal gear...
@@spaghettiking7312 Implying that doesn't make him even more of a chad
Pretty awesome that he cucked his beta father, ngl. Hal Otacon "CHAD" Emmerich
@@manniacc2681 Damn straight.
And thus, a sick bromance was born.
More precisely, bromance between a otaku(Otacon actually means otaku convention) and a hardened soldier.
Wrong Snake and Emmerich, tho.
@10,000 Videos With Actual Full Effort Videos? u crazy man
@@uberman64 no, It's Dave and Hal
feels good being the 400th like.
It's nice to see that Hal is so much better than his father
Breaking the curse
Takes a lot of guts to decide to stay behind even knowing you're going to be nuked into oblivion. (Yes, it later turns out that's not going to happen, but when this conversation takes place no one knows that yet)
mhm
Yeah, but how does Otacon make it to Fox Island?
@@doddsino Snake specificslly asks Roy for someone to come and pick him up as soon as he gets out of the tunnel at the end, along with Meryl
I’d be comforted knowing at the very least the potential bunker busting nuke would destroy me long before I could properly suffer
Otacon is the best character in MGS1 and he's great in MGS2 also
I'll stay here
ARE YOU CRAZY!?
I need a little more time to resurrect wolf's body
@Dr. Complex "tessarakt"
@@wyattjoss3858 is thaf a marvel reference
Hehehe
Campbell: "Oh, they're not going to drop a bomb on you guys." :D
Otacon: "..."
Otacon will always be my fav character Bc of this game.
Heh, Snake is such a killer, yet he didn't even want to think that anyone who he considered a friend would die... Gray Fox, Otacon... Great guy.
Otacon is a nerd hero
Hell yeah he is ✨
I guess its kinda nice that despite losing one best friend in the same game Snake gains another
Mr. Red 88 good point. Never thought about this.
I remember this... I remember getting the game, and playing it through...
I didn't cry at the time, ut now, it sends shivers through my entire body. Love that game.
I cried uncontrollably when I first played this and it still makes me cry. Someone you love like a brother risking his life to save the people he cares about!! This Is ABSOLUTELY EMOTIONAL!!!!! especially with the music. And each note fits perfectly with what they are saying. I feel like crying right now. It's just too touching! 😢😢😢😢😢😢😢😢😢😢
Their conversations hit like a truck, absolutely incredible!
Can you please stop cutting onions, dear room ninjas?
1:24 And at the end of the story it was Snake who died next to him...
this game is a lesson in life....theres truly something amazing about the game and its ground breaking story
thanks :)
Thanks
Thanks...? Oh that sounds nice.
I believe in you.
Thanks, Snake
True friend words.
The beginning of the greatest bromance in gaming history
The most legendary bromance in video games history
This game is full of feels moments
"we're about to be bombed"
"oh boi"
Otacon will always be my Homie
thats what i was going to say... he survives both endings, thats why the "meryil dies" ending is considered a BAD ending... cuz she dies for real (and thus, non canon ending)
personally, I prefer the "bad ending". Otacon and Snake's relationship feels more natural than Snake and Meryl's.
Wow, I didn't notice how much Snake's voice has changed since MGS1.
Snake:We're about to be bombed...
Otacon:Oh Boy...
It should have been...
Otacon:Snake we're about to be bombed...
Snake: OTACON WHAT THE FUCK!
Uhm Otacon isn't supposed to die. The bombing is cancelled.
Still, the moment was heart-wrenching when they believed it was going to happen.
Thankfully, that grouch of a secretary of defense got arrested after Campbell got into contact with the President!
A war espionage veteran found a friend in a anime gundam enthusiast.
WHY AM I CRYING IN THE CLUB
To remind all that skipped the codec-conversations near ending:
Campbell stopped the ones that were trying to bomb Shadow Moses and sent someone who could get Otacon out of there. Thats what happens in Meryl´s ending.
;o; No Otacon, you have so much to live for!
how nice snake said thanks *sniff*
that sent shivers down my spine
Mgs1 codec sequence is the most charming
Otacon: I've found a reason to live... you.
Snake: !
Bittersweet. But you all have to watch the mgs2 snake and otacon handshake now to complete the bromance and feel whole! Lol
OOOOOOOOOOOOOOOOOTTTTTTTTTAAAAAACCCCCCCCCOOOOOOOOOOOOONNNNNN!!!!!!
David Hayter seems to have made it sound slightly older in MGS4. In MGS1, snake is at best point of his stamina in his whole life.
Right in the feelings!
Listening to this after playing all the other games, you can tell this really is David Hayter's first time doing Snake's voice because it sounds a little different from the sequels and Twin Snakes, since he was probably still trying to get the voice completely down.
I honestly think it's his best, even better than the Twin Snakes version. It sounds way to raspy in the later games.
Snotacon APPROVED! :D
Otacon is a huge chad.
Metal Gear’s story telling is so good🥵😩🥴🥴
xDDD già la lacrimuccia alla fine :cry:
They both survive because campbell cancels the bombing run ;]
fuck , i won't cry after this epic shit
They could have just made this conversation and be over with. But they just HAD to add this music to make it cheey romantic. ^^
The bromance always was real between the two.
No bromance... Between brothers who found each other in the most difficult times, learning and growing together.
The world only needs 1 Snake, & 1 Emmerich.
Sooo, looks like that TH-cam want some heads, so I deleted most of my video. Hope this one will not get down. Thanks TH-cam, next time i'm gonna sing every songs in my videos.
Serves you right for putting alien subtitles in the video
still up!
I keep playing this over and over to hear the song that plays during Otacon's uplifting words. Is that in the soundtrack?
no wonder they have a pairing together ^-^
story wise it go's MGS 3 4 1 2 is the last 3 and 4 are about big boss 1 is about his clone the 2ed one is about him finding a replacement.
in mgs4 I would have like to revisit the whole shadow moses...like the commander's room and where Snake killed Vulcan Raven
Heh, been a long time since this comment and you might not even read it, but I hope you enjoyed each moment of MGS4 as much as I did back in the day, and of course, I hope it was a joyful surprise to see that what you wanted came true :)))
No, Solidus Snake (then known as George Sears) stopped the bombing run, not Campbell.
Yeah, the nuke was called off in the Meryl ending.
If it wasn't, Snake and Meryl would also be dead.
O H B O I
ok, Since otacon dies, they started a new game with otacon in it.
happy that Kojima didnt choose one or the other to live in canon
Damn. Imagine if they did go with the planned ending of having them both executed to the song here's to you.
The Patriots press the "I don't like" Button 4 times.
@searchin4hentai Otacon survives in the Meryl ending
thanks to the nuclear bomb cancellation
This is just his excuses, if meryl dead he come with snake, if meryl alive then otacon dead. It just because the motorcycle don't have enough space
Otacon was simping for Sniper Wolf pretty bad.
Does this sound like some sort of sexual innuendo to anyone except me?
This "escape route" talk? The "small entrance"? He just "unlocked" it?
Uh huh...
In such tragical circumstances, no innuendo was intentional. He was going to die in a nuclear, fiery death (or so he thought). I see nothing sexual about it.
I think you need to get laid OP.
indeed,you like Snake/Otacon like me? ^_^
Atleast, thats what I think.
The reunion must have been awkward. Here Otacon was, all prepared to make a heroic sacrifice and die to ensure Snake and Meryl survived, possibly finding some level of redemption for creating a nuclear-launching superweapon, and looking pretty cool while doing it in front of the coolest person he ever knew...only for the nukes to be called off and for him to be unceremoniously picked up by an evac chopper. I mean...damn, being alive's great and all, but it sure must have been embarrassing having gone through all that drama for nothing.
Otakon is Kojima and the presumed player.
deponds what u do in the torture scene
Hal.... Hal.... HAL!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
The fucking piano made me laugh rather than emotional xD
Chris and dave ...
Hal is the goat
good to see there are people who see snake and otacon for who they are, not what fangirls want them to be.
boyfriends
@Sanguiluna The same thing goes with ocelots voice. In MGS2 its more gruff.
how can you spoil this game? it came out in 1998 anyone who hasnt played it by now just fails at life...
Daily reminder that his nickname is short for otaku convention
“They’re going to use a surface-piercing nuclear bomb. It won’t hold!” “I’ll stay here, I found a reason to live.” “What?!”
@CarlVercetti
Are you using an emulator? If so, there's actually a MGS that was made for PC.
Did they actualy bomb the place with a nuke? If so why is Shadow Moses still there in MGS4?
The Colnel reveals in a codec call that the order to bomb was cancelled.
I know it isn't I just don't want spoilers for it.
How did otacon escape eventually?
after the bombing orders get rescinded, snake tells campbell that otacon is somewhere on the base.
it's most likely that a squad of soldiers were sent in to extract him.
And thus yaoi was born
If Meryl dies it's not their last conversation =O Think about that!
Lets just imagine they drop the surface piercing nuke... what chances would have snake and meryl to survive and not get hit by the blast wave or die of radiation sicknes? How far away have they to be and would it be possible to be this far away? You also have consider the debris that is flying miles trough the air. I don´t know about you, but I would rather stay in the facility like otacon the end it quickly without much pain.
thats sad...
actually theres three,
sheep, shepherds, and hypocrites
its called enclosere look it up but u can only fidn sniper wolfs verson
MANLY TEARS. T_T
Bombing couldn't have happened. Shadow Moses was intact in MGS4.
Is the music included or for editing for the video?
I still hate Ottacon’s dad tho
43rd President Of The United States, George Sears (later revealed to be Solidus Snake), found out that Secretary of Defense Jim Houseman had ordered the bombing of Shadow Moses. Sears countermanded the bombing, and forced Houseman to step down as Secretary of Defense, saving Solid Snake and Otacon.
26k views? OMG. I'm really shocked xD! Thanks everybody!
he didn't did he?
Toccante...cmq alla fine si salva...quindi :D
is this italian?? EPIC
thats wot i dnt get bout mgs 4 how meryls in it coz in mgs 2 snake n otacon seem to b a team but they never mention meryl in it so it seems that they followed up in mgs2 from the then ending of mgs1 wit otacon n snake getting out of the base, leaving meryl if thats the case then how does she get in mgs4
either way there awesome games n mgs4 just rules