I really feel that Karkat is the most innocent of all the trolls. He never completely "hated" anyone, and he's the one who spontaneously burst into tears the most. Another note, when he turned around to see Kanaya sawing off Tavros's legs, he FAINTED. It doesn't really give the sense of weakness, just that he doesn't really like actual violence that much.
his blood is pure red just like humans his ancestor was the most kind and loving out from everyone his dancestor was the most caring and most protective out from everyone and Karkat himself was the most innocent and most scared out from everyone You could say that Limebloods are representation of all good and humane in trolls society that was gone right after Limebloods got exterminated. @@coolguy7461
Holy crap, I just now picked up that the veins mimic how Noir killed each of the kids. John - stabbed in the back through the chest. Rose - stabbed through the stomach/gut. Dave - shot by bullets, multiple entry points. Jade - none; Bec Noir never killed her, and the veins are surrounding/caressing her.
+Sugarskull Dave essentially made Jade kill him. He didn't tell Jade about it and did it indirectly so that Jade would kiss him to make his dream self wake up to deliver the tumor.
All of the troll's names are made with A, T, G, and C. Putting them in order of server > client reveals the following code: TACCCAACGCCTGAAGATTCAACGTAC Whatever protein this codes for is infinite, because no STOP codon is present. It's infinite nature means it's completely unpredictable but impossible to make for any finite creature such as ourselves. I'm sure it has no significance in the story though.
I thought that the cancer imagery was from john changing his handle from GT to EB due to karkat's influence, thus disturbing the "DNA strand" or whatever it's actually called.
Scratch/Lord English enslaved the Condesce, who sent Dave the Miracles Video. Dave sent the miracles video to Gamzee which triggered his insane rampage. Gamzee's insane rampage caused him to summon the clown into John's bedroom which would eventually be prototyped into his session. That clown is what gave the silly hat that Jack Noir hated so much. That same silly hat is the reason that Jack noir was eventually motivated to take the Queen's ring, and eventually gain Becquerel's power, which would give him the necessary tools to become Terminal and actually be the cause that sent the entire universe to utter shit. In other words, its not Karkat's fault. Every single thing that transpired here and eventually fucked everything up circles back to Lord English/ Doc Scratch. That's what's really sad about this.
I think it reveals a lot about Karkat. No matter how angry and tough he's ever acted, once Karkat thinks he's seriously caused a catastrophe, he immediately apologizes. He's a pretty nice and gentle guy at heart - there's a reason he's a Prospit dreamer - but he's afraid of dang near everything - his enemies, his friends (which he doesn't know he has), his future, his past and himself most of all. He's a jerk, but it isn't his fault. In a weird way, not a single one of the messed-up things about him and his story is his fault. He never chose to be a mutant, to have his classpect or his denizen, or to get caught up in the mess that was the beta trolls' session. It got to him - he wound up in pointless struggles with himself and blamed himself for everything. If he'd let anyone else reach out to him, he could have found a kindred spirit. In the end, he wound up lonely because he didn't, and that made everything worse. ...Good god, this guy needed a hug. After watching the ending, my only problem with it was that Karkat didn't get to open the door, to make up for what he was denied in his own session. It was nice to see him finally win a victory in Collide - breaking Clover's luck is more of a feat than most people realize. One can only hope that he's doing well on Earth-C.
to be completely honest i think Lord english probably put the entire existance of homestuck into a massive doomed timeline (im not too sure about how the alternate reality stuff works so il just leave it out) but basiclly because lord english comes from the beta/alpha kids session and in his session the game glitches because it chooses a cheriub which mean it will always go to a dead session. which means that lord english would then go back and then do all that stuff in the game to make sure he exists and gets his power. In short because caliborn killed caliope and caused the dead session it means that no new universe will be created and as long as lord english exists, reality is stuck in a doomed timeline.
Late as all hell, but I disagree. Karkat/Vriska is the lynch pin. Karkat initiated the troll attempts and because of that Vriska got involved. Through her, she wanted to directly impact the alpha session, going so far as to let Bec to get prototyped. You can't solely blame Karkat, but he is definitely the "start" of this one big ol' stable time loop orchestrated by Lord English himself.
Galactic Cancer is a song that truly conveys the hopelessness and darkness that Karkat must have felt. After blaming the rise of Jack Noir on the kids, he only realized after things started to go horribly wrong is when he had tried to find shortcuts in the game that would end up eating him alive. Now, guilt rests heavily on his shoulders: the deaths of his friends and hatred against himself. Hearing this song, one feels for a moment the misery of Karkat Vantas.
If you read the part in act 4 when karkat receives the virus from sollux, karkats notes that the virus apparently curses the recipient and everyone they will ever know, so in short Sollux cursed kk, who cursed everyone. damn it sollux!
I just want to hug Karkat sometimes. And by sometimes I mean always. He beats himself up and he doesn't deserve it. That is not the face of someone who failed, and felt bad about it. That is the face of someone who long thought they shouldn't even exist in the first place, then failed, only, in their mind, solidifying their theory. He thinks he's a freak of nature, born a failure, and I hate that about him. Because he isn't. He's different, so what. He deserves to pick himself up and move on.
Karkat, it's okay. You were a gr8 leader. We all had fun in the process, even if the entire universe got cancer. Don't 8lame it on yourself. You did your 8est.
This gave me some deep chills, considering Karkat's ancestor was the nicest and helped a ton for the rebellion, but for Karkat himself, he ruined his entire universe when his Ancestor made it better. that feel.
I feel so bad for Karkat. He's the only one of his kind with cherry-red blood. He felt as if he was put on this planet with this blood as a punishment. Then, just when he thought that he was his peoples savior, leader and friend, he finds out that the ruin of their world, was all his fault.Somebody needs to give that guy a hug. A really big "IT'S ALL OKAY NOW" kind of hug.
karkat really had it bad, born as a mutant in a hemoist society, believed he caused the deaths of his and all of his friends lusii, had most of his friends kill eachother, believed he gave an entire universe cancer, poor guy
like it makes me think , "damn, a whole bunch of scared confused kids ended their worlds and had to go through dangerous life changing things while watching eachother die."
I love the track art for this, how the red miles-looking things represent how Jack killed each character. Except for Jade, who is protected by a shield of them.
Honestly, me and Karkat have so much in common, if i gave my whole universe Cancer i'd be really upset and mournful, i'd keep moving though, even though if i kept moving it would pop up in my head sometimes, thats probably how Karkat feels too.
This is such a sad and emotional tune, especially when combined with the picture. You can really understand the guilt Karkat must feel through it, in all different shapes and forms. The beginning of the song is filled mostly with extreme remorse and despair, only deepening as it continues, until 1:56, where I imagine him watching in horror as everything fall apart in the kids' session up until 2:17, at which point, whilst feeling great regret still, he sees hope for them to survive.
Karkat has grown so much as a character, maybe more than anyone else, maybe even more than Vriska or Rose. i hope one day he accepts himself for who he is, accepts that he has fucked some things up and moves on.
That picture, along with the song, yes it is like Majora's Mask again, a strong sense of pity for those who are going to die, but a stronger feeling of sadness/anxiety wondering if and how they'll make it out of such a situation. This is truly beautiful how emotions are stirred not only by the chill of the song, but also by the artwork.
Casual reminder that Jack Noir is completely Karkat's fault because he felt it was more important to fight the Black King early and didn't correctly breed the Genesis Frog.
Form This Way Correct me if I'm wrong, but didn't Gamzee cause the universe to be diseased throught his chucklevoodoo? Because: 1. Gamzee chucklevoodoos the universe, which puts a harlequin-looking doll thing in John's room on Prospit. 2. This causes John to unknowingly draw harlequins on his walls, which in turn leads John's dad to believe that John likes harlequins. 3. This results in John getting the big harlequin doll for his birthday. 4. John prototypes the kernelsprite with the harlequin doll, so the imps, ogres, and so on receive its characteristics. 5. As a result, all the carapacians on Derse are required to wear silly outfits, which upsets the B1 Jack Noir. 6. Then Jack kills the Black Queen and takes her ring, so he receives the characteristics of everything prototyped pre-entry. 7. Later, Vriska meddles and puts John to sleep, so he can't prototype anything in Jade's kernelsprite. 8. This in turn leads to Becquerel jumping into the sprite, giving B1 Jack all of Bec's powers.
Well actually his first and last name also relate to cancer. He took suggestions from people and choose names from there, and they were named such because his Sign
+Drake Piona Karkat is the embodiment of Cancer lol. or I guess technically, the constellation and zodiac was named after him in the story of homestuck
Cancers can't move on, they live in the past. Everything they do wrong, big or small, haunts them forever after. Why else would Karkat constantly pick fights with his past in future selves, if he wasn't constantly regretting his actions?
Because most of us have fucked up big time too, and we can relate to the pain you feel, see ourselves in you. And as much as we would be angry in other circumbstances, we can't. We can't because we would be getting angry at ourselves too all over again and that hatred is so poisonous it hurts. We just want to be forgiven and wanted again, so we forgive you and want you too. Did that make any sense?
You can't live with just a breath,whilst blood is missing,nor can you just live with blood whilst breath is missing. these two aspects are aspects that keep one alive. John and Karkat are both needed,is what i think.
I've never been sure, is the cancer Bec Noir, or the Red Miles? Because the red miles sure look like something sickly and cancerous. I think canon says its Bec Noir but I find it hard to believe the cancer is a game construct we know exists in all games, and just became what he is through an unfortunate series of circumstances, likely orchestrated by Lord English. [EDIT] I somehow completely forgot about the giant bomb literally called "the Tumor"
It gets worse, there are two types of timelines, the alpha timeline, and doomed timelines, in the doomed timelines everyone dies, so even if they did EVERYTHING right. They would've still died. The horrible clusterfuck of bad luck and sadness that is the Homestuck we read is as good as it gets for them....
@FreakyDeakyMia That was exactly the impression I got too, gave me chills. It's even worse because Karkat had previously assumed he was literally a god to the kids, their creator and their better - only to realize with a horrible jolt that he was actually responsible for the failure and death of their entire universe.
I can't help but think that poor Karkat would be burdened by the thought of it being him that caused the whole thing. The fact that his friends have to hide in fear of being killed, the humans being stuck with an unbeatable enemy, having a failed matespritship to Terezi and thinking Dave as his prick of an enemy... It practically makes me want to cry. And all the murders he's had to witness... It's really just THAT sad...
Something I just noticed...in the background there, you can see the Red Miles stabbing through all the kids...except for Jade, in which case they appear to be cradling her. Now which character was it again that Jack Noir could never bring himself to kill?
You are a beautiful human being with a beautiful mind. All of my yes. Thank you for pointing this out to all the haters out there hating on Karkat. I truly thank you. :)
Just look at that picture, you can see the shame and depression he feels, he truly inside is friends with all these troll and few humans, but he's been put into troll society where feelings don't matter. Karkat is truly the most emotional and backstoried troll I've seen so far. He only wanted to avenge his loss but only lost more in the process. His angry outside is only a coverup to keep the true Karkat safe. Karkat is more human than any of the other trolls.
"His Trollian handle is a play on the medical term "carcinogenesis" which is the development of cancer in the body (or carcinogens, cancer-causing substances), and "carcinology," the study of crustaceans." From the Wiki to your heart.
agreed. Just my opinion, but I think that Vriska and Karkat are both so well developed, it's scary. It's like they're real live human beings. Or real live troll being. Whatever.
What Karkat really needs, I think, isa vacation where he can worry about nothing and friends that care as equally about him as he does them, and all of them need to enjoy themselves. Karkat more than anyone deserves to be happy.
Which makes his wanting to join the threshcutioners more of something he felt forced to do, instead of wanting to do it like he acted (and lied to himself about)
The cancer that Karkat created was basically Jack Noir! Jade hasn't been killed because Jack Noir is combined with Bec, and as we see in Cascade, Bec's loyalty to her prevented Jack Noir from killing her, and in fact carrying her to her quest bed! Whereas he killed everyone else, no problem.
embed0000 Aw ma gawd this would result in instant death. Imagine someone beeing depressive 12th grades with incredible powers and the wish to destroy everything. *#GreenMilesEverywhere*
I really feel that Karkat is the most innocent of all the trolls. He never completely "hated" anyone, and he's the one who spontaneously burst into tears the most. Another note, when he turned around to see Kanaya sawing off Tavros's legs, he FAINTED. It doesn't really give the sense of weakness, just that he doesn't really like actual violence that much.
he's the most human out of all of them
his blood is pure red just like humans
his ancestor was the most kind and loving out from everyone
his dancestor was the most caring and most protective out from everyone
and Karkat himself was the most innocent and most scared out from everyone
You could say that Limebloods are representation of all good and humane in trolls society that was gone right after Limebloods got exterminated.
@@coolguy7461
@@coolguy7461Maybe that is where humans come from, his blood
Holy crap, I just now picked up that the veins mimic how Noir killed each of the kids.
John - stabbed in the back through the chest.
Rose - stabbed through the stomach/gut.
Dave - shot by bullets, multiple entry points.
Jade - none; Bec Noir never killed her, and the veins are surrounding/caressing her.
Wasn't Jade the person who killed Dave (albeit on accident)?
+Sugarskull Dave essentially made Jade kill him. He didn't tell Jade about it and did it indirectly so that Jade would kiss him to make his dream self wake up to deliver the tumor.
I saw it as: Jade- killed indirectly by Noir via ordering a subordinate to do it for him.
I guess the artist was a smartist
and also the frog got hit in the everywhere
All of the troll's names are made with A, T, G, and C. Putting them in order of server > client reveals the following code:
TACCCAACGCCTGAAGATTCAACGTAC
Whatever protein this codes for is infinite, because no STOP codon is present. It's infinite nature means it's completely unpredictable but impossible to make for any finite creature such as ourselves. I'm sure it has no significance in the story though.
You were _really_ bored in Biology, weren't you? I approve.
I thought that the cancer imagery was from john changing his handle from GT to EB due to karkat's influence, thus disturbing the "DNA strand" or whatever it's actually called.
@@professionalsleeper6281 OMG
It not their names, it their chat handles.
my dixlexic ass: tacocat is spelled the same front and back
When you realize Karkat hasn't spoken to Jade since Cascade.
AGH
*SCREAMING* HUSSIE PLZ.
STOP PLS
Hussie's biggest oversight.
WHY HUSSIE WHY
Scratch/Lord English enslaved the Condesce, who sent Dave the Miracles Video. Dave sent the miracles video to Gamzee which triggered his insane rampage. Gamzee's insane rampage caused him to summon the clown into John's bedroom which would eventually be prototyped into his session. That clown is what gave the silly hat that Jack Noir hated so much. That same silly hat is the reason that Jack noir was eventually motivated to take the Queen's ring, and eventually gain Becquerel's power, which would give him the necessary tools to become Terminal and actually be the cause that sent the entire universe to utter shit. In other words, its not Karkat's fault. Every single thing that transpired here and eventually fucked everything up circles back to Lord English/ Doc Scratch. That's what's really sad about this.
well, Caliborn did say that all his actions are to secure his existence, one way or another
oh. oh no. this boy is sad but its not his fault. oh no. please not my tiny angry boy. no.
I think it reveals a lot about Karkat. No matter how angry and tough he's ever acted, once Karkat thinks he's seriously caused a catastrophe, he immediately apologizes. He's a pretty nice and gentle guy at heart - there's a reason he's a Prospit dreamer - but he's afraid of dang near everything - his enemies, his friends (which he doesn't know he has), his future, his past and himself most of all.
He's a jerk, but it isn't his fault. In a weird way, not a single one of the messed-up things about him and his story is his fault. He never chose to be a mutant, to have his classpect or his denizen, or to get caught up in the mess that was the beta trolls' session. It got to him - he wound up in pointless struggles with himself and blamed himself for everything. If he'd let anyone else reach out to him, he could have found a kindred spirit. In the end, he wound up lonely because he didn't, and that made everything worse.
...Good god, this guy needed a hug. After watching the ending, my only problem with it was that Karkat didn't get to open the door, to make up for what he was denied in his own session. It was nice to see him finally win a victory in Collide - breaking Clover's luck is more of a feat than most people realize. One can only hope that he's doing well on Earth-C.
to be completely honest i think Lord english probably put the entire existance of homestuck into a massive doomed timeline (im not too sure about how the alternate reality stuff works so il just leave it out) but basiclly because lord english comes from the beta/alpha kids session and in his session the game glitches because it chooses a cheriub which mean it will always go to a dead session. which means that lord english would then go back and then do all that stuff in the game to make sure he exists and gets his power. In short because caliborn killed caliope and caused the dead session it means that no new universe will be created and as long as lord english exists, reality is stuck in a doomed timeline.
Late as all hell, but I disagree. Karkat/Vriska is the lynch pin. Karkat initiated the troll attempts and because of that Vriska got involved. Through her, she wanted to directly impact the alpha session, going so far as to let Bec to get prototyped. You can't solely blame Karkat, but he is definitely the "start" of this one big ol' stable time loop orchestrated by Lord English himself.
I THINK I GAVE IT CANCER...
I GAVE YOUR WHOLE UNIVERSE CANCER, JADE…
SORRY.
It is bad that i found this funny? ._.
Me when I heard this for the first time (literally, I swear that happened): "OH MY GOD, OMG, OMG, OMG, OMG,OMG,OMG OMGOMGOMGOMG-
Hussie to the entirety of the internet
@@royalcomputer3780 Honestly this.
Galactic Cancer is a song that truly conveys the hopelessness and darkness that Karkat must have felt. After blaming the rise of Jack Noir on the kids, he only realized after things started to go horribly wrong is when he had tried to find shortcuts in the game that would end up eating him alive. Now, guilt rests heavily on his shoulders: the deaths of his friends and hatred against himself. Hearing this song, one feels for a moment the misery of Karkat Vantas.
I feel so sorry for Karkat, he acts like he can take everything, but in reality, he's scared, scared and lonely. That is at least how I see it.
Such truth.
i just saw that i wrote scared twice xD
gosupergirl123
no!!!!!!!! i thought u wrote ass 20 times
carmen jordan wow, sarcasm. that's original.
Just remember Carmen can't spell, capitalize the beginning of their sentences or use punctuation. :) *I *you and slap a period on that bitch.
I think Karkat has to be the most depressing in these situations, such a beautiful yet tragic song
DUDE STOP BEING EVERYWHERE XD jk, jk you have a good taste in music and videos. Lol
Davekat Is BÆ why thank you sir Davekat shipper :3
+Just a normal troll HELLO
psychoticFangirl is Pestering you
HELL-O BRUH
Just a normal troll theres no escape
Might as well be renamed to "Memos of a failed god", because we all know what log this track was custom made for.
When Karkat said he gave an entire universe cancer I was like:
WHAAAAAAAAAAAAAAAAAT!?!?!?!?
And if you think about it more, his sign on his shirt is the zodiac sign of cancer
Topaz Cock Yeah thats mainly the first thing that came to mind when he said it, and I was so flabbergasted.
Homestuck is totaly mindfhack! XD Cancer (that usualy killing fandom/universe) is already in the plot of the story itself!
IKR
I Always Read Karkat's Last Memo Aloud While Listening To This. Talking About How He Gave Everyone And The Universe Cancer. I Cry Every Time.
Why Are You Talking Like Kanaya
It's A Cool Quirk Deal Wit It.
Xx JupiterCat xX Kanayas Quirk Is The Best But Jakes Speech Is Better. Death With It COMBOX2
K
If you read the part in act 4 when karkat receives the virus from sollux, karkats notes that the virus apparently curses the recipient and everyone they will ever know, so in short Sollux cursed kk, who cursed everyone. damn it sollux!
Karkat may be a teeny tiny bit too aggressive, but he has to put up with a lot, and I'm proud to share a star-sign with him.
"Galactic" is a massive understatement in this context honestly
nm i just spotted the reference to Karkat's trolltag
I swear to god
I just want to hug Karkat sometimes. And by sometimes I mean always. He beats himself up and he doesn't deserve it.
That is not the face of someone who failed, and felt bad about it. That is the face of someone who long thought they shouldn't even exist in the first place, then failed, only, in their mind, solidifying their theory.
He thinks he's a freak of nature, born a failure, and I hate that about him. Because he isn't. He's different, so what. He deserves to pick himself up and move on.
....okay this is VERY depressing and dark, considering that Karkat was one of the major causes of homestuck events.
Libertades Chronicles, and the fact that he didn't talk to Jade after cascade.
The fact that he's a mutant...
No it actually was Lord English
No it actually was Vriska Serket
@@gatorelacionessexuales233 EVERYTHING IS VRISKAS FAULT AND I WILL ALWAYS STAND BY THAT STATEMENT
this picture makes me so sad.
Heather I KNOWWW
i stopped being a homestuck fan like 7 years ago yet i still think about this song... the number of amazing unused homestuck songs is wild tbh
LOOK AT JADE BEING CARRESSED BY THE VEINS BECAUSE IT HAS BEC IN IT...THIS IS SO FUCKIGB SAD
MY FEELS
AUGHHHHHHHHH
*WHYYYYYYY*
are you people insane O_O
PylonBuffering Hey, I blame Hussie
Fil Does
i can get that some people are a bit sensitive but why are people freaking out over this fact
Karkat, it's okay. You were a gr8 leader. We all had fun in the process, even if the entire universe got cancer. Don't 8lame it on yourself. You did your 8est.
ALL OF THE FEELS. ALL OF THEM.
This gave me some deep chills, considering Karkat's ancestor was the nicest and helped a ton for the rebellion, but for Karkat himself, he ruined his entire universe when his Ancestor made it better.
that feel.
I think there was actually a line at some point where someone told Karkat he'd be a better human than troll.
I think it was john the one who said it.
@@nubesloc4s It was Vriska, she told John.
I feel so bad for Karkat. He's the only one of his kind with cherry-red blood. He felt as if he was put on this planet with this blood as a punishment. Then, just when he thought that he was his peoples savior, leader and friend, he finds out that the ruin of their world, was all his fault.Somebody needs to give that guy a hug. A really big "IT'S ALL OKAY NOW" kind of hug.
karkat really had it bad, born as a mutant in a hemoist society, believed he caused the deaths of his and all of his friends lusii, had most of his friends kill eachother, believed he gave an entire universe cancer, poor guy
the way this song scares me and makes homestuck 20 times more intense as a story then it makes it out to be.
like it makes me think , "damn, a whole bunch of scared confused kids ended their worlds and had to go through dangerous life changing things while watching eachother die."
One thing that you notice after finishing reading Homestuck is that when you analyze things you realize that Homestuck is a very sad work.
STARTS TO CRY VIOLENTLY
I love the track art for this, how the red miles-looking things represent how Jack killed each character.
Except for Jade, who is protected by a shield of them.
tfw you give the universe TERMINAL 7 BRAIN CANCER
RIP
+Fil Does JOHN, YOUR UNIVERSE HAS TERMINAL 7. THIS IS WHAT IT LOOKS LIKE JOHN.
***** XD
Nah
It's blood cancer
@@igelfullmetal1307 What about the Consorts Karkat? What about the Queen?
Honestly, me and Karkat have so much in common, if i gave my whole universe Cancer i'd be really upset and mournful, i'd keep moving though, even though if i kept moving it would pop up in my head sometimes, thats probably how Karkat feels too.
This is such a sad and emotional tune, especially when combined with the picture. You can really understand the guilt Karkat must feel through it, in all different shapes and forms. The beginning of the song is filled mostly with extreme remorse and despair, only deepening as it continues, until 1:56, where I imagine him watching in horror as everything fall apart in the kids' session up until 2:17, at which point, whilst feeling great regret still, he sees hope for them to survive.
karkats symbol is cancer and i think that just makes it sadder
Karkat has grown so much as a character, maybe more than anyone else, maybe even more than Vriska or Rose. i hope one day he accepts himself for who he is, accepts that he has fucked some things up and moves on.
someone give this child a hug.
its kinda fitting that the guy with the cancer symbol gives somthing cancer
music has never actually given me shivers before, but my chest feels tight and my breath is caught in my throat
1:56
*GETS TO ME EVERYTIME!!!*
This is possibly the saddest song in all of Homestuck.
I defy you to tell me otherwise.
Serenade
GOOD POINT GOOD SIR.
//.................gameover...........carne vale...Do you Remem8er me....\\
Jade Harley Carne Vale isn't a sad song.
//Nvm\\
Karkat! Love you buddy :)
That picture, along with the song, yes it is like Majora's Mask again, a strong sense of pity for those who are going to die, but a stronger feeling of sadness/anxiety wondering if and how they'll make it out of such a situation. This is truly beautiful how emotions are stirred not only by the chill of the song, but also by the artwork.
my guy really gave cancer to the universe. this comic is insane
oh jeezus the synth/organ part is so good
I'm still salty from the fandom's treatment of this poor child
Wdym, they hated Karkat?
Casual reminder that Jack Noir is completely Karkat's fault because he felt it was more important to fight the Black King early and didn't correctly breed the Genesis Frog.
Wasn't that Kanaya's job though..
(Don't worry I adore Kanaya)
HappyCatGraystripe Karkat rushed her. He was too worried they wouldn't make it in time,though they had time to spare.
Form This Way no matter what it had to happen if changed would create a doomed time line aradia new it had to happen
Form This Way Correct me if I'm wrong, but didn't Gamzee cause the universe to be diseased throught his chucklevoodoo? Because:
1. Gamzee chucklevoodoos the universe, which puts a harlequin-looking doll thing in John's room on Prospit.
2. This causes John to unknowingly draw harlequins on his walls, which in turn leads John's dad to believe that John likes harlequins.
3. This results in John getting the big harlequin doll for his birthday.
4. John prototypes the kernelsprite with the harlequin doll, so the imps, ogres, and so on receive its characteristics.
5. As a result, all the carapacians on Derse are required to wear silly outfits, which upsets the B1 Jack Noir.
6. Then Jack kills the Black Queen and takes her ring, so he receives the characteristics of everything prototyped pre-entry.
7. Later, Vriska meddles and puts John to sleep, so he can't prototype anything in Jade's kernelsprite.
8. This in turn leads to Becquerel jumping into the sprite, giving B1 Jack all of Bec's powers.
***** Doesn't change anything, really.
funny how karkat's symbol is for the constelation cancer. and this video made me realize this. :/
+Drake Piona carcinoGeneticist means cancerous genetecist
hussie planned this and we all know it
Well actually his first and last name also relate to cancer. He took suggestions from people and choose names from there, and they were named such because his Sign
Wow!
+Drake Piona Karkat is the embodiment of Cancer lol. or I guess technically, the constellation and zodiac was named after him in the story of homestuck
you know something that actually makes alot of sense when you think about it.
The art and the music combined... OH KARKAT COME HERE HUG TIME SHOOSH BABY IT'S OKAY I LOVE YOU
Seeing the album art almost made my cry because Karkat my son no
Just like in that game,not only do you know that the characters are going to die,but the characters are so easy to get attached to.
Karkat you poor thing let me hug you ;_;
Urgh, this theme hurts... You can practically FEEL Karkat's guilt and sorrow through this song.
play this with rainy mood, perfect.
CG: I GAVE YOUR ENTIRE UNIVERSE CANCER, JADE.
This fannart is so beautiful, it works amazingly with the song.
Cancers can't move on, they live in the past. Everything they do wrong, big or small, haunts them forever after. Why else would Karkat constantly pick fights with his past in future selves, if he wasn't constantly regretting his actions?
Because most of us have fucked up big time too, and we can relate to the pain you feel, see ourselves in you. And as much as we would be angry in other circumbstances, we can't. We can't because we would be getting angry at ourselves too all over again and that hatred is so poisonous it hurts. We just want to be forgiven and wanted again, so we forgive you and want you too.
Did that make any sense?
The music is haunting enough, then... you see the picture, and it's like you feel something heavy drop on your chest.
Of all the souls I've encountered in my travels, his was the most ... human.
the one type of cancer you cant keep contained
Poor karkat,sad and good theme :)
I find that the part that starts at 1:55 gets to me the most when I'm listening to this song. Sadness tends to settle in at that time.
You can't live with just a breath,whilst blood is missing,nor can you just live with blood whilst breath is missing. these two aspects are aspects that keep one alive. John and Karkat are both needed,is what i think.
Gahh I can't stop crying.....
I lost my grandpa to cancer but I refuse to believe it's your fault Karkat! I love you!
tmw your not in a fandom but listen to music from that fandom
What a strange feel indeed (I am in that fandom).
*KAW KAW*
HOW DARE AN OUTSIDER ENTER THIS AREA!!!
IT IS LEVEL 4 CLEARANCE REQUIRED!!!
hey you should read it.
OHMYGOG. I SAW IT AND THE MUSIC WAS ALL LIKE THINKY AND STUFF. THAT WAS SO COOL. THANK YOU FOR SAYING THAT.
That feel when you give an entire universe cancer
this art combined with the song gives me so many chills
and an odd feeling of nostalgia
hmmm
I've never been sure, is the cancer Bec Noir, or the Red Miles? Because the red miles sure look like something sickly and cancerous. I think canon says its Bec Noir but I find it hard to believe the cancer is a game construct we know exists in all games, and just became what he is through an unfortunate series of circumstances, likely orchestrated by Lord English.
[EDIT] I somehow completely forgot about the giant bomb literally called "the Tumor"
It gets worse, there are two types of timelines, the alpha timeline, and doomed timelines, in the doomed timelines everyone dies, so even if they did EVERYTHING right. They would've still died. The horrible clusterfuck of bad luck and sadness that is the Homestuck we read is as good as it gets for them....
*feels of being a cancer*
*hugs Karkat and sobs profusely*
@FreakyDeakyMia That was exactly the impression I got too, gave me chills. It's even worse because Karkat had previously assumed he was literally a god to the kids, their creator and their better - only to realize with a horrible jolt that he was actually responsible for the failure and death of their entire universe.
This song and picture are making me whimper like a newborn puppy.... KARKAT WE DON'T BLAME YOU!!!
This song makes me feel that Karkat is/will be the hero of Homestuck. While John is the protagonist, Karkat is/will be the true hero.
**Cries**
rip feels
But seriously I LOVE THIS SONG
***** TTvTT
***** same lmao
I find this very, very fitting as a theme for Karkat; more so than Crustacean.
This song makes me so sad, yet it just sounds so amazing.
Poor Karkat. You have all of my sorrow, my patron troll, all of it. :c
I can't help but think that poor Karkat would be burdened by the thought of it being him that caused the whole thing. The fact that his friends have to hide in fear of being killed, the humans being stuck with an unbeatable enemy, having a failed matespritship to Terezi and thinking Dave as his prick of an enemy... It practically makes me want to cry. And all the murders he's had to witness... It's really just THAT sad...
Something I just noticed...in the background there, you can see the Red Miles stabbing through all the kids...except for Jade, in which case they appear to be cradling her. Now which character was it again that Jack Noir could never bring himself to kill?
You are a beautiful human being with a beautiful mind. All of my yes. Thank you for pointing this out to all the haters out there hating on Karkat. I truly thank you. :)
Just look at that picture, you can see the shame and depression he feels, he truly inside is friends with all these troll and few humans, but he's been put into troll society where feelings don't matter. Karkat is truly the most emotional and backstoried troll I've seen so far. He only wanted to avenge his loss but only lost more in the process. His angry outside is only a coverup to keep the true Karkat safe. Karkat is more human than any of the other trolls.
Karkat at this point is the ONLY troll who hasn't been on either side of a murder (not counting dream selves).
Ye gods it's so much more emotional with the song art.
When the drums bust in this song turns so awesome.
that part made me cry.
Karkat apologized. Its so sweet yet heartbreaking.
He was even presented cases in which he had good cause to kill someone (like Gamzee), but instead, he found a peaceful method of dealing with them.
This is the song that plays when you fuck something up so much it genuinely changes someones life for the worse.
"His Trollian handle is a play on the medical term "carcinogenesis" which is the development of cancer in the body (or carcinogens, cancer-causing substances), and "carcinology," the study of crustaceans."
From the Wiki to your heart.
omg, i love this piece and i love the art....makes me wanna cry..
it was in this moment, karkat knew, he fucked up.
agreed. Just my opinion, but I think that Vriska and Karkat are both so well developed, it's scary. It's like they're real live human beings. Or real live troll being. Whatever.
the knight who couldn't saved anyone
I want Sburb to be a real game one day.
Minus the part about everyone on earth dying.
What Karkat really needs, I think, isa vacation where he can worry about nothing and friends that care as equally about him as he does them, and all of them need to enjoy themselves. Karkat more than anyone deserves to be happy.
That's why he's the troll that everyone relates to.
No. Nope. Nope. Feels, man, All the feels in the--
KARKAT GET OVER HERE I NED TO HUG YOU! ;-;
karkat is a precious baby and should be protected from himself at all costs
Which makes his wanting to join the threshcutioners more of something he felt forced to do, instead of wanting to do it like he acted (and lied to himself about)
love this compilation. thank you man.
Jade escaped Red Miles... She's not skewered, and she can clearly get out of that, unlike her friends... simple mistake? or fvcking EVIDENCE?
The cancer that Karkat created was basically Jack Noir! Jade hasn't been killed because Jack Noir is combined with Bec, and as we see in Cascade, Bec's loyalty to her prevented Jack Noir from killing her, and in fact carrying her to her quest bed! Whereas he killed everyone else, no problem.
Kat O'Donnell BUT OF COURSE... dat realization tho. :P
Kat O'Donnell I always wonder what would have happened if Jade had prototyped her dream self BEFORE entering the Medium
embed0000 Aw ma gawd this would result in instant death. Imagine someone beeing depressive 12th grades with incredible powers and the wish to destroy everything. *#GreenMilesEverywhere*