Hoarders Aren't Just Messy, They're Trauma Victims
ฝัง
- เผยแพร่เมื่อ 1 ต.ค. 2024
- Meet Julie. Julie has had a lot of trauma in the past few years which has triggered some hoarding. She grew up in a hoarded home, but actually kept a clean and tidy home for the most part up until a few years ago when she had multiple traumatic events occur. Hoarding was one of the ways she dealt with the trauma. Find out more about Julie's particular case and even hear straight from her some of the things that she has been struggling with.
This is the first in what will be a series of videos of this home as we go through and declutter and clean different areas of the home.
Amazon affiliate links for some of my favorite cleaning products: (I make a small commission when you use my link)
Barkeeper's friend cleanser
amzn.to/44Veo2a
Microfiber cloths
amzn.to/42G0U8W
Ultra fine microfiber cloths
amzn.to/3QF21ky
Mr. Siga detail cleaning brush set
amzn.to/47e7N30
Bathroom Crevice Gaps Cleaning Brush
amzn.to/3Sr7aPd
Wire Brush Set 3Pcs
amzn.to/3RPWEzx
Steel scrub sponge
amzn.to/3SK2vIH
Krud Kutter Kitchen Degreaser
amzn.to/3RJsfTD
Razor blade scraper
amzn.to/3IcCuM6
Tub Tile scrubber brush
amzn.to/3o5vNES
Dawn Platinum Powerwash
amzn.to/42ZyfM4
Clear Storage Bins Stackable Plastic Containers for Organizing, 8 PACK Multi-size
amzn.to/3SsUCHj
Mr. Clean Clean Freak
amzn.to/3SJo3p3
Zep Oven and Grill Cleaner
amzn.to/40HRE45
Super Clean Degreaser
amzn.to/3qQQjKs
Scrub Daddy sponges
amzn.to/3o2ip4e
Scrub Mommy sponges
amzn.to/41JlXWW
Scour Daddy
amzn.to/3W4RMsa
Floor squeegee
amzn.to/3MtrsEG
Mr. Clean Magic Eraser
amzn.to/47B504n
Magic Cleaning sponge
amzn.to/3Oo3EmG
Easy Off Oven Cleaner
amzn.to/3pOMzIE
Kaboom bathroom cleaner
amzn.to/3sKXkO4
Swiffer
amzn.to/3OgnC38
The Pink Stuff
amzn.to/3pHDZvo
Broom and Dust Pan set
amzn.to/3MukMq0
Baking soda
amzn.to/42FDCjz
Libman scrub brush set
amzn.to/42D2aKd
Weiman Stainless Steel Cleaner and Polish
amzn.to/441AM9v
Sprayway Glass Cleaner
amzn.to/3Xe6i17
Liquid Gold Wood Care
amzn.to/3pDKSya
ALTRA Women's Trail Running Shoe
amzn.to/3Oi54zl
It was My Pleasure working with you. You are such a sweetie to help this person out. I would love to come and help more. Can't say thank you enough for the opportunity. Like Bonnie says please be kind in the comments. She really needs the help. She is a sweet and kind person. Send Love and Hugs Not negative comments. 💞😍😘🤗
Mean people can just suck it. ;) You did a great job!
You are a mega cleaning machine 😊 I’d want you to clean my house, trouble is I live in England ! Good job Lisa ❤
Thanks, Lisa! It was fun working with you! You're a powerhouse! We'll do it again soon!!💜❤️🥰
you two have the golden arms
We'll spin kick em out of the room! 😂@@jonfen1657
Bonnie's mom here. This has been quite the project. I'm glad I could help my daughter clean.
Me too! Thanks for your help, mama!🥰😘
You are amazing! I miss my mama. So glad B has you!
I can see where Bonnie gets her hard work ethics and determination from. Enjoy seeing you both help eachother and your exchanges together are just wonderful! You are an amazing mom and raised an amazing daughter! Thank you both for helping and helping the viewers too!
Yidikkddkkhhdkohkdkkkkdoofssgkgsigohsghogkhskhohhodhgofkdosohodhffgff GG fkahgafkaddkoododoofddjo hohosgoakagaoaaghhagadgkh ggodhkodkgsooafkahhjdohagoahaohaoahohaoaogadahgoaahogahgoaogahoahhaahahaahofdjofajahaodhajaofafoaogaodhaosfoahoakhofoofodododokdfpfhaafjafkjkdkdkohojkoajdogsjdaojdookgsfkaosfagofaaha GG akokojogoaohsfaohfoadjaoffaoddoahhaoagoaogafoaogdoaoahogoffooddoahogahdofhsjjdojghaaahgjaofaodjohahaofagoaohsgoadafodakaofofodododkfahajsajdododdkghaksfajgoskgskodosogfasdooogaodoaofdoaohfoagofakaohodfoajhaohaahahfoadoofahodhaodadadoofooddosojakfkkkkhjsgakdoor-to-door haha of an of half ad gfhaaahafffa GG fhaffgggohgjsjsjsgggofohagoogagogggggjsjsjsujsgigggofodogggggggggggodoggsogooggʻggjsdsjfgidggofodoooggooggogggʻhaahaafhaf GG fffffggggghaaffffffffafjfggg GG ohhsjsdfoggdog ft ggodogodogoooooiisoododgofofohahaaf GG faffoffgggggg GG ggjdigododgofooggʻgf GG fgaaaaaaghaahaahPapagpaaagajjsjgaHsgaaidisjidofaajodhaosodajfoagohaahagaajaaahgaajsjsajgaagasJhahhagajagjsoahsaaphaohhaoasgsjjsaGhaaadaahajsuagapajfpapjaaaaugaoaahhshaoaahahgaHgGAASFougahidfoaaooapagaaahfaGaaaaajsshaagaaaaaaaaaaaaaaaaaddjsaaahahahgaaaaaa GG GG aaggaggaaaaagaahaussaagasagaiaahgagaofaaaaaidosgaoahgoaaaahsaahausgaaaaaaaagaaagaaaaasuuahuFihaisusiahhishahaahushaGhausgausagSsgKrxsfoaofuagaaaaaausgaaahaaaaaaaaagagaaaausgaugagagausgaaasgaafaugaugagaaaahahaaaaffgaffusgaggagagaagghadaushsigaishaahaahasaoggooagaaaaaaaaaaaaaaaaaashususgaisigaaahgaaaaaoaaofaoougausgaaaaaaaauahhaaaaafaagasgaaaagaasgaaaagaaagaaaaaghaahgaff GG fhagaaggagofgaaaausuiidhaadihisahohagaaaahaodihasaagaaaaaausautahgaaagaoaogagaagaagagagaagaaaugaàagafaaaaaaaaaagaaaaaaaaagidgaauggaaggagaaaaaajsgaagoosgaooaouggaagaagaaggagaaaaaaaahahaaihaususifahaifihaFhahaaausofaaaidqidagaaaaahgaaaaagaaggaaaaaaaagaaaaigaaaaahafhaf GG gggaoaaajsgajsgsdihadiodoiofaaagafoaoooaoaoiggagaagaUusgDFhafojsgojogóiruofoififudfifgidgidifdyggifiddidfdhofhofgffhirrugrgirhirgrhtiuirrhrheuuuoeuuuoruurfruofreuirieirgieigeueiegifyififgruofuuigidgidofujoejjhduogidfufuofidudidfidudiffdfuidfoufuidddiddgdgidididididididdhididuiduofduuiddudidhiduduifididududidudididggggiuirirttourtyouuùùuuuù9yu9y9uùùotu9yu9yùuy9ùotu9yu09yu9yu9yuu9yu99yu9y99ùu9y0uout uuuùùùùù9y99ui9y9yì9yi9yu999yuìiiiì😊ù8r9r999tt9t9yup iruu I tr@@kateavedissian3273
I think what your daughter is doing for all of these wonderful people is so admirable. She quite obviously cares with her whole heart. I suffer from PTSD and a lot of childhood trauma that I’m working hard on with a lot of help and I think for me the one constant on my journey is the complete absence of any kind of judgement because in reality, no one wants to be at risk and now at 39 and having severe degenerative disc disease and 2 botched spinal fusions and more surgeries to come. No one chooses trauma. We all deal with things in many different ways but at the end of the day we are all humans. I absolutely love watching these videos for what your daughter does and you as well ❤ but it also helps to not feel so alone. Very inspiring all the way around ❤ you’re all a true blessing
It never ceases to amaze me how a small group of women can come together and help change another woman's life for the better. This is the definition of Girl Power! We all need support and understanding from others and this was so wonderful to see. You rallied around her and lifted her up with your help!
🥰🙏
People really criticize how you clean?!?!! Wow I’m always in awe of what you accomplish.
IKR!!!!?💕🌟💕🌟💕🌟💕🌟
Yup, it's weird. At least for every criticism, there's at least 2 to 300 other people who are very encouraging.😊❤️
Love to watch you & listen to you explain the what, why & how of your process.
In this video I loved that you had help. It's a lot to do for one person.
Your mom is awesome. And, Lisa. It's fantastic that you gave her the chance to help a person also.
I find it weird that they criticize- the whole concept of helping others seems to escape these people
Me, too!
One of the most important concepts you mentioned and demonstrated in this video was the idea of compassionate "companioning." Three generations of women being present to help another woman who is suffering. It used to be common in communities, but not so much these days. I was deeply moved to see it in action again in this video. Thankyou to Bonnie, Mum and Lisa.
Yes, I'm learning that is a big part in helping these individuals. They need to feel listened to and understood before they can really trust you enough to actually help them. I think so often people would come in and just toss everything out because it's not valuable to them, but that just re-traumatizes the person to whom it is valuable to. It's sad that so often their voice has not really been heard.
Im surprised how many perfect people there are in the world that they can judge people so harshly. I think its great that people like Bonnie, Mack, and Barbie and all the others have created a community to help people.
😊❤️🙏
Also have a look at another channel in this circle of cleaning angels: Coline Cleans. She is in Holland.🇳🇱
@@annwilliams6438coline cleans
Worth the wait! Bonnie, STOP! being so apologetic about yourself. STOP!!!!! You are a force of nature, as is your Mother. The welcome addition of your helper looks like the beginnings of an army!
Was I? I actually don't remember being that apologetic in this one, but it's very possible. Still getting that confidence. Thank you for your kind words!💕
True. Never complain, never explain.....no need.
@@ABeautifulMessExtremeCle-zl1wpyou're doing a million times better with the not apologizing.
your mom raised a winner
You and your mom are amazing and “Julie” is great for asking for help. As Mack says, even if they regress they had a period of living in a clean, orderly space. Such a blessing!
seems this poor lady has had very little support, physically or mentally. you are an angel in disguise.
I’m one of those people who have a “trauma timeline”. Once things reach critical mass your nervous system basically goes into partial collapse. I actually started mysteriously fainting at random times without medical explanation. I almost had to give up driving because I’d be found passed out in car parks. Anyone standing in judgement of people like this lady have probably not walked a mile in her shoes, or they have had sufficient support around them that they were able to cope just enough to get through. I get it. The human body and psyche was never equipped to endure unending high levels of traumatic stress without periods of recovery. I’m doing much better now but my heart goes out to everyone fighting for their survival. Bonnie, you are truly a blessing to humanity.
I agree with your statement about the human body and psyche not being "equipped to endure unending high levels of traumatic stress without periods of recovery." Very well said. I'm so glad you're in a better place and I hope "Julie" can get there. If you are just starting this series of her house, you will see by the last one that things did not end up very well as hard as we tried, but I'm still holding out hope she will get the therapy she needs to truly deal with this disorder.
I so agree with you ❤️🩹
@ABeautifulMessExtremeCle-zl1wp I typed a comment, but wasn't sure if you'd see it. @ 10:45 may I ask where you got that pod/ how I may contact them?
@@JustJ-Me It was through a company called Velox, but I think they may just be Utah-based. I'm sure if you Google "storage pod rentals near me," you could find something similar.
I don’t think it matters how you choose to clean as long as the outcome is the same, there may be faster methods or methods that are better for the enviroment but for messes like this… as long as it gets clean and improves the owners quality of life who cares how you get there. Thank you for being so willing to help people clean up their homes, I’m sure it brings them such relief!
I like watching videos like this where people are helping other people clean and declutter their homes. I feel I get inspired to clean and declutter and organize my own home
Thanks, Tracy! I'm glad it inspires you. 😊❤️
HUGS for Julie. Life is hard and sometimes we fall short. I stand all amazed that you were able to ask for help. And thank you to all of your helpers. Have a great weekend. ❤🩹
Absolutely right. We ALL fall short somewhere. That's what our Savior is for. 🥰🙏
@@ABeautifulMessExtremeCle-zl1wp I most certainly know how hard it is to ask for help. My clothing has been in disorderly heaps for AGES. But tonight we (my hubby and I) grabbed a BIG trash bag and filled in all the clothing that I no longer wear (nor do they fit), but they were too good to trash. So tomorrow my friend gets TWO big bags of clothing to look at. (And I told her another friends name who can take, what she can't use). It feels SO good.
That's so awesome! It DOES feel so good!
The fact that you are willing to take on such a huge job with so much compassion is inspiring. That kitchen looks fabulous! What a great team effort. :)
Your helper is a very good cleaner. She is a keeper. Great Job ladies!
Agreed!!
Bonnie, thank you for being so open in sharing the isses you had in school with your shyness. Your emotion in talking about this brought tears to my eyes. 😢 I know many of your followers empathize with you. That time of life could really be challenging!! Thank you for your work and service to orhers in need!! I love watching you.💖
Thank you so much!
I appreciate the way in which you handled this cleaning. Hoarding is a very debilitating mental health condition.
I really admire you, I would not know where to start ! Thank you for helping Julie.
It amazes me how you are able to sort out all that chaos. It must feel really liberating and a bit weird for Julie to have so much more space available.
I work as a social worker and I have seen my fair share of flats in more or less catastrophic states, I wish there were more people like you! I know how hard it is. ❤
(And yes, I often helped my clients to start the process of decluttering and cleaning. Especially the younger ones who are often quite clueless about keeping their flats in check or how they can conquer their laundry, dishes and overall stains.)
I loved doing that and I always tried to get my hands on these clients. 🥰
I have a friend that has hoarding issues, she allowed to help her once when her older daughter was getting married and she wanted a small Gathering at home. I couldn’t understand her, but I remain quiet and help her. She did had a couple of traumatic events in her life. Thank you for helping me understand her better.
Of course. It is a hard thing to understand and I still don't completely get it, but I'm trying.
I would have to wear ear plugs to be able to cope with her incessant talking. Just what you've shown makes me feel total panic!! Just the talking, not the stuff. That is amazing that you do her laundry. You never cease to amaze me! As I've gotten older it has been harder to keep the amount of things under control, so I understand with trauma how it can consume. I pray this will make her feel amazing! Great job!!!
Yes, honestly, all the talking was hurting my brain. 😬It has been better the last couple times I've been there as I have been working in the basement and more by myself or with one other person.
@@ABeautifulMessExtremeCle-zl1wp Would wearing noise canceling headphones (when the noise becomes too much) help? Maybe something you can try 🤷🏼♀️
Whos the other lady?
@@jeanchecefsky3791 that's Bonnies mom☺
I agree. Even with the video being sped up is driving me crazy 😮 God bless you for helping her ❤
It's amazing that there are people who take time out of their life to watch an entire video and then make the effort to craft a snarky, hateful remark. Who has the time for such negativity?! Oh, they didn't actually watch the video? They just scrolled, saw a few seconds with an imperfect situation, made a snap judgment, and then allowed themselves to feel superior by leaving an ignorant uninformed comment. Well, I am not sure who I pity more, the person who hateful or the ignorant. Well, it's not the home owner because she's got Bonbon on her team! Great job Bonster and great job Home owner, so proud of you both.
Yep, you described perfectly the type of scenario that I envision when people leave negative comments. I never feel bad for deleting those remarks because they didn't even take the time to watch the video and I can tell from their comments. So...buh-bye! 😊
Wow, Bonnie! You really upped your game with this cleaning! What a tremendous amount of work. 💪The living room looked so much better. And you even did the laundry! 🫶
Your mom has such a young spirit and a loving heart!! 🩵 I hope Julie will feel a sense of relieve after this. 🩵 Love X Coline
Thanks so much, Coline. 💜I think we wore her out this last week, so we may need to take a break this coming week and then get back to it. I certainly wouldn't mind the break either. This has been a big job. But I also don't want to lose momentum, so it's a tough call. I guess we will play it by ear.😊
I think it’s so important when the homeowner is involved with the cleaning. You all did such a great job!
Loved this video. I think Julie is so brave to put her life out there and to face her trauma. Julie if you read this, you are making progress. I am so glad that you are taking control of the trauma. I struggle with depression and grief. On bad days I give myself 5 - 10 minutes to feel my feelings and that is all I give it . It is still deep down inside, but I am able to function better than I could before. Love and hugs.
It must be so hard for people to reach out for help but wow would it be life changing for them to have a fresh start! Fantastic job as always!
Great work! The “trolls” will find their way to try to spoil something that is working. Such sadness and ager resides in them. BUT, you rise above them because, they will never understand true goodness.keep on keeping on. I understand completely working quietly. It’s therapeutic and calming. You are wise to accept help in certain situations in order to get the job done. Bless you.
Thank you! I think next time I work there, I'm going to try to pick an area to work on with some earbuds and music on because I definitely have had a lot of anxiety with all of the constant chatter while working there, but I knew it was kind of necessary especially in the beginning to have that much help and that much input from the homeowner, but now that I know a little bit about what our goals are, I feel like I can work a little bit more on my own and get a lot of organizing into categories done.😊
God Bless you guys for helping without judgement.
I think you have a super power in real life Bonnie. This is going to make the home owner feel great. When you have a messy or hoarded house it really weighs heavy on your mind and self esteem. You are very inspiring! ❤👏👏👏👏👏👏👏👏
You are so kind to help people get back on track, organized and in comfortable home. Your mother is also amazing to help you with this.
Thank you for everything you do, Bonnie! I follow your channel for a long time and I watched you help so many people (including Mira from Peeling away the clutter - she is amazing!) and I'm amazed by what you do for other people!
I like watching Mira too
I appreciate it!🥰
Never worry about the ones that criticize...you are doing great things...i am new to your chanel and i am binge watching as many as i can ...it motivates me to get my place done
Oh, thank you so much! I'm glad you're here!
Bonnie you and your Mom are so kind to help Julie, she will remember you forever! Not many people would do all that you did for her.
The world is a better place because of you and what you do.
Bonnie I am thinking that the length of the video + the pixelation effects might have been the reason why your software caused you trouble. I work in video production and I would be happy to help troubleshoot or give you some tips if you like. Cheers from Canada 😊
Yes, I'm sure that had a lot to do with my frustrations on editing this one particularly. I wish it was just limited to that one. Unfortunately, even on smaller projects, it has been super slow since they updated their software and added in AI tools... which I don't even use. And they won't downgrade me to the old version like I asked them to because I'm on a subscription plan.😞
What software do you use for editing? There are a lot of them out there, but only a few that I can actually use on my PC since most of the simpler ones are meant for editing right on your phone and that just doesn't work with what I'm doing.
You are really a beautiful person. And a blessing for us people who need your help. God bless you.
Love what you do on your videos! Sorry if you have to read bad comments. Really sad that people are criticizing others… You make a huge difference in other women’s life and it’s what is important. Like to pass some time with you ♥️
Thank you, Caroline! 🙏💜
Bless you for all your hard work, compassion and understanding! ❤
The seemingly subliminal “call 911” made me giggle. Wonderful job as always!!
Right?!😄
Amazing job! As you said, it is difficult to understand hoarders, as it is a mental disorder, but it is great they can have your help!
One thing you can be sure of is that messy people or hoarders do not want to live like that. It’s just overwhelming and it’s hard to make decisions where everything should go. The clutter is part of their disorganized mind. (. Speaking about myself here. Not really a hoarder but very much a clutter bug. Also many work long hours and are exhausted when they get home.
Thank you all for helping this homeowner.❤
I know you said it doesn't look like you did a lot in that family/living room, but it really does! Also, I don't mind the longer videos at all! Unless they're harder to edit, then I totally get it. I can't wait to see the rest of the series, and I'm looking forward to the merch! If able, I think a super cute or sassy dishwasher magnet about clean vs. dirty dishes would be awesome. ❤
Oh thank you! I haven't even thought of magnets in a merch shop. That's a great idea! Thank you for sharing that idea!❤️😊
While we're on the topic of merch ideas, you might want to use this one from my dear mom... "I just love work -- I could watch it all day." 😀 Thanks for all you do, Bonnie. Keep being you, and God bless you! 🙏🕊
Y’all helped this woman out in a huge way. Very admirable 💜
That looks great, she is very brave. I know how hard it is to let go of things , the panic inside. You're so strong to be doing this and allowing others to help. I wish you so much happiness. ❤❤❤
Wowza.😮 That was a tremendous amount of work. What a fantastic job. You're all such a huge gift! Bless you for your service
Thank you so much!
Wtg Mom! She was a great help! I miss my Mom everyday.
Wow this is a huge overwhelming task to take on Bonnie. I admire you greatly for getting stuck in and helping this lady to recover her home whilst also retaining her dignity. She recognizes her problems and is taking the necessary steps to heal. I am glad she is accepting your help and not feeling like her voice is ignored amongst the many others. Maybe that's why she's so chatty with you all, because she feels heard for a change. Well done to you, your mom, your helpers and the lady herself!
Thank you so much!
Feedback- just fyi the sped up voices is very jarring and headache inducing. I turned the audio down but then missed out on any voice over or when Julie was telling her story. Speeding up the video is fine, but not leaving sped up voices in. Thank you, Bonnie for helping this family! Love you and your mama ❤.
That's the hardest part about this is figuring out what to do with those parts of the video because, I can leave the video sped up and mute the clip, but nobody likes it when I add music and I don't have enough to say with a voiceover to be able to talk the whole time. So, it's either just complete silence or I tell everyone to not talk while we are cleaning. It is a lot easier to edit video when I am just working on my own, which is why I usually prefer that, but I can't really do that with this house. Figuring out how to make videos that please everyone is so hard. That's why I apologized right in the beginning that there was going to be some sped up voices because I knew that was annoying to a lot of people, but I just don't know what else to do. But, thank you for the feedback. If I ever quit youtube, it will be because of the editing and trying to please everyone. I may need to take a poll to see what most people prefer...sped up talking, music, voiceover about something random, or silence. Or maybe I leave it at normal speed and have a super long video...or cut out even more. 🤷♀️I know I am way overthinking this, but that's what my mind does with feedback. I just want to make good videos! 😓 Time to create a poll...
Unfortunately, I have to agree. It actually made my anxiety spike. But, I do love what you do. Great job!
Thanks to you she is taking down the physical manifestation of her emotional walls. It's never easy for these folks to do that after multiple traumatic experiences. And the subliminal 9-1-1 call was a perfect description of where Julie was. You and your mom came to her rescue.
FYI-I noticed that she shops at Winco. They have barrels for plastic bag returns right at the entrance to the store. At least they do at my store.
Bonnie you amaze me with your work ethic and nonjudgmental of everyone you work with. Thanks for taking us along.❤
Wow, Bonnie! Good thing you had help. Awesome, as always.🙂👍🏻
Bonnie, you and your mom make an amazing team! Great job as always❤❤❤
Love mom saying…shouldn’t we put the stuff with tags on in a separate bin? She’s in my tribe. Lol
Bonnie, I saw a cleaner use a pool noodle to fill her dish tubs. It worked! It’s like a faucet extender!
@@LaurelChinnRealEstate-Fairfax 😂
Aw, thanks!
Had to pause this one twice - once to dust my living room furniture and once to clean my entry way floor. Thank you for getting me off my behind! And thank you for what you are doing for others. You make a difference.
That's the best reason to pause a video.😄 I love that it motivated you! I also will put on one of my favorite cleaning channels while I am cleaning to casually watch and listen to because it helps to motivate me. It's kind of like I'm cleaning with a friend.🤗❤️
I carry my phone around with me while dusting room to room while playing cleaning videos and set phone on mantel, hutch ect... great company and motivation and get to watch in between dusting pictures and knick nacks ect., folding laundry, doing dishes, ect. , I end up looking for things to do to finish a video! tks Bonnie! (Mack, Barbie, Mira!) (Coline too!) You each have your gifted Super Powers that motivate us, but you are all incredible making the transformations happen! Gives us all hope looking at our weekly, daily, monthly, yearly messes and awesome cleaning tips too!
It is very kind of you to help out 'Julie' so she doesnt lose her home. Its a shame some people dont understand this condition and can only be negative.
Awesome cleaning video. Terrific help by all cleaners for this family! 💜
Thanks so much! 😊
Good morning 🌄🌞🐰🍵 blessings 💞🙏🏾 awesome 👍🏾
Good morning!
Good job, all of you 👏 👍 💪
I've got to hand it to you, Bonnie for being able to work while there is so much chatter. I like to work alone when I can just get in the "zone", so to speak and allow my mind to focus on the tasks at hand without interruption or an audience. But as big as that job was, it almost required a team effort. Hoping this is going to help "Julie" in more ways than just making a mess go away. That it will be a motivation and a fresh, new beginning for how things will be handled in future. ❤
Yes, absolutely. I do my best cleaning when I'm just alone and in my zone, but in a situation like this, you have to take all the help you can, which unfortunately, can be super overwhelming to my brain and sometimes it's hard to even think straight to know what to do next. But, I'm sure it's even harder for Julie to let people come in and touch all of her things, so I can't complain about not being able to work alone. I think I will suggest next time I'm there that I just take a room, put in some earbuds, and just work on that space so that I can really focus well.😊
You do such an amazing job.... Thank you for helping...
You were so patient. That looks like a very long but rewarding process.
I love how you spray the dishes and soak them in the huge totes.
So awesome. That oven now needs shades to look at now. So shiny!!❤
😄
Your mom is quite the go-getter, I see where you get it. Once again you and your merry lil band of helpers are doing wonderful, kind, caring things the Beautiful Mess way, love it !!! ❤❤❤ It was definitely worth the wait Beautiful Bonnie. This is that old lady from the live, Angus is my cat. 😂😂😂 Hope this lady can heal properly and go on to have a great life.
Oh, yes! I remember saying, "Angus?" on the live because I wasn't sure if I was reading it correctly because I figured you were female, and that just didn't fit. That makes sense now.😅 Well, I'm certainly not going to call you "that old lady from the live."😁 So, what is your name?
Great job as always, thank you for helping them, you were a Godsend!
Personally, I like the voiceovers most
Good Lord Hun. You worked and scrubbed your fingers off. Hoarding disease runs in my family. My Mother was a hoarder and her Mother was too. I have a sister that is buried alive. Alot of people don't understand the disease. I'm not sure I fully understand it myself. Thank God I didn't inherit that gene. I'm more of a "Clean Freak" since growing up in a situation like that. God bless all of you for helping this lady and her husband get some kind of order back into their home. You guys did some detailed cleaning up in there. 👍👍🫂❤
I have decided it is up there with schizophrenia as far as one of the worst mental disorders. It really disrupts so many things and, not only is it usually caused by trauma, but it can traumatize all of those involved in the hoarder's life. I totally understand going the exact opposite direction growing up in a house like that and yet I also understand how that just becomes the norm and you just continue living like that. It's such a difficult thing to treat and so sad to watch what it does to the hoarder and their family.😔
I would love to here you talk about your cleaning plan like first I’ll pick up the rubbish then bag majorly of clothes etc great the owner is helping 👍🏻👍🏻
What a great job! You are an angel. I couldnt do what you do. Not that i wouldn't help. I just have a weak stomach. You are a blessing for these people, and I'm sure the gratitude that they have is immense. God bless you for all you do. Btw your Mom at 72 is a little spitfire 😊❤️
Bonnie, I’m telling you. You are a blessing to so many and your mom and helpers too. And did her dishwasher not work?
Thank you! And, no, her dishwasher didn't work. I forgot to mention that in the video. They really just use it as a drying rack.
Looks like your fighting a loosing battle. Tidying a hoard, moving it from one place to another. Hope the lady is getting the help she needs, it can be life changing if she can. Not many people would help or can help these people. What a great job your mom is doing, in her 70's as well 👏 The horror of all that washing up, will never complain again lol.
Bonnie said that Julie is in therapy, which is a hopeful sign
Wow, big job! I wish I knew you guys and lived close by cause I would have loved to help if I could. My mother in law was a hoarder, and I understand how difficult it can be to clear this type of situation. Thank you for being so kind and patient and for having the big heart that you do! Also, big thank you to your mom also! Hope that the help you're giving Julie truly helps her now and in the future!
Thank you for being understanding. You know better than most. It's so hard to watch as a family member, I'm sure.😓
I checked my phone 17 mins after you loaded. 😂. Glad things worked out and you were able to process the video.
Me, too. Thanks!
Watching your video was informing and uplifting. I was glad to see your message about about respecting the hoarder no matter what. Often people tend to belittle those who have this issue. Please do have more voice overs explaining what your methods are : example gathering plastic bags in one place in order to recycle later or gathering all tagged clothing to go through later, all other clothing to be washed , boxes ??? I hope you “get my drift”! Looking forward to more shows.
Amazing video as usual. Such an achievement for the family 😍
while I don’t really understand why someone would leave a hateful comment, I am super excited you are there helping her ❤❤❤ kindness is always so motivating
Thank you, Lisa.😊❤️
Hi, I am not sure why you speed up the talking? I cannot understand any of it and its hard to listen to while I do want to hear the cleaning and picking up.
Loved seeing your mom working alongside you. She's awesome!! And so great of Lisa to help out.
I give you enormous credit for being able to handle the chatter. I would not have been able to do it. Way too much stimulation for me.
You are a blessing
I was actually losing my mind a little bit with all the chatter. I had to make other arrangements the other times that I went over there to make sure that I wasn't surrounded by so much talking. It was kind of necessary those first couple of days just because we had limited room to work in and a lot of people helping, so just discussing how to do things was necessary. It wasn't easy though.😬
This looks like a big project! Really nice of you and others who helped, especially your mom. 😊
I absolutely appreciate the work you do. I learn from watching and listening. My brain is a little different and you and Mac have helped me see some important things about myself. I always thought I was a “slob” but I also knew that wasn’t the right word. I’ve never been dirty but messy…. I’ve struggled with clutter my whole life. Child of a hoarder who never really had anyone to teach me…. I tried to do better with my own kids and cleaning and messes and clutter- thanks Marla the Flylady. But I still have a way to go
Thanks for sharing!😊
Hi I'm new to your channel, Thoroughly enjoyed the process, Julie is a lucky lady to have such wonderful help.
Thank you so much.😊
Wow, 72 years old. Impressive energy. Way to go.
Great work! It’s easy for everything to get out of hand when there is a bunch of higher priority things going on in life. Accumulation is real and it happens.
I empathize because I had a horrible case of Covid (21 days of bilateral pneumonia) where I didn’t regain my stamina until 1.5 years later. Staying alive by breathing was the top priority then the day job. A relative dying and the combination of households is also something I can empathize with; it’s not easy.
Absolutely. Somebody can be on top of the world one day and then get sick or have some traumatic event happen and it turns their life upside down. That's why I encourage people not to judge these situations because, this lady used to be pretty neat and tidy until all of the multiple traumatic events. So, you just never know. I'm sorry to hear about your covid complications. My best friend is still dealing with long covid and it has been a nightmare for her. It's been almost 3 years and she is still nowhere near what she was like before covid. It really did a number on some people.😢
That kitchen looks brand new. You all did a fantastic job well done and keep up the good work.
😊 It's so good to watch these shows because I learn something every time. When a person feels overwhelmed and doesn't know where to start, they can do just what you did. Start with one small spot, like you did, and move out from there. One bit at a time. You prove that it's doable if you just start. I'm just like you tho when comes to too much chattering. I can only handle being talked at for a short period. What you all did here was so so wonderful. It is just overwhelming for one person to handle and they just need some help. You're the best. I've gotten lots of tips from all you cleaners as well that I put into practice and it juat feels good when we get more organized. Thank you.
Thank you for your kind remarks!🥰
Since when can an HOA tell you how the INSIDE of your house should look?
I was a little confused about that as well. I did ask her about it and her answer didn't really clear it up super well for me. Her daughter will be working over there this week, I think, so maybe I will ask her more about that because I also thought that they could only fine you for things on the outside of the home.
I’m almost 71 and I think your mom could run circles around me as the saying goes. 😂 in fact I have someone help keep my home clean every two weeks. Getting on my knees is a big deal lol. 😁Thanks for another great video and all your hard work getting it to us. ❤️
Even getting on my knees is painful and I'm 46! She is having a harder time getting up from that position, but she's still doing amazing!
Ohh potatoes are one of the things that make the worst smells.
Wow this is a huge job. Delighted that Julie and her hubby asked for help, left so many in to help and worked alongside ye. That’s a very brave move for Julie especially. It was also great to see your mam back with you and Lisa helping too. Belated happy birthday to your mam. The kitchen is looking great. I’m looking forward to next weeks video already. Have a great week. Mary Messer, Joes wife. 👏👏👏👏👏💪👍🙏💐🎂🎈🎁🎊🎉
😊❤️🙏
Bonnie your mum is awesome ❤. It's true that keeping active physically and mentally is the best. They say use it or loose it. I've lost some due to a medical condition but I do as much as I can. I've always been on the go! It was amazing to see the transformation of the living room. And doing this with the home owner rather than over taking is definitely more helpful. It gives them the control and I think that helps them to keep it from getting out of control again. Great job everyone, and Julie you choose a fab name 😉good morning from England 🏴💞
The thing I love about Dawn Power Wash is that a) it doesn't damage wood as it cleans and b) everything smells so good after you use it!
So much hard work! So many details! Wow!!! What an amazing group of women you are 😢
You, your mum and Lisa have done a wonderful job with this kitchen. I know it is a work in progress and I can't wait to see what you have done in next week's video! I just love what you do, helping others x
Thank you so much!
I think you are a wonderful kind person, what you are doing is a gift to those who needs help for many different reasons, I live in UK I wish I could find someone like you over here i need help so if u want to come to UK I would welcome u with open arms, I love your videos ty for sharing with us but mainly ty to the person u are help for sharing ❤ xx
It seems like I need to come to the UK. You're about the 5th person who has said they would gladly welcome me to come help them. Maybe I need to tour the UK and clean some houses there.😄❤️
The one thing i learned from watching many cleaning channels and also from dealing with my hoarder Dad is that do not get involved with collecting ANYTHING.
😁
You have a gift that you share free. What a joy you are to others 😊
Wow, thank you
It’s so satisfying to see the transformations - what a blessing you are to the homeowners you help! I love your kind, nonjudgmental attitude as well!💕
Thanks for the video Bonnie. I am so sorry you had to spend so much time on the editing, etc. We do appreciate all of your hard work. Blessings dear one.
Thanks so much! It has been a rough couple of weeks, but it's finally out.. haha! Thanks for the support!
A big 🫂 for Julie ,her daughter and for you and your mother ❤
Hey, at least with lots of garbage bags and boxes, you had plenty of places to put things, wherever they needed to go. Great work!!!
Very true!
Lessthan 5 in and im loving the way you cleared a small spot and vacuumed. Already improved! ❤🎉
Quick win!😁
You and your mom are Rock Stars!