How Did Our Most Famous Ancestor Really Die?
ฝัง
- เผยแพร่เมื่อ 13 ธ.ค. 2022
- The brand new Eons Puzzle! store.dftba.com/collections/a...
And the 2023 Eons Calendar! www.complexlycalendars.com/pr...
Did our most famous fossil ancestor, Lucy, die by falling out of a tall tree? The answer is part of a decades-long debate over how, exactly, our ancestors transitioned from life in the trees to life on the ground.
*****
PBS Member Stations rely on viewers like you. To support your local station, go to to.pbs.org/DonateEons
*****
Produced by Complexly for PBS Digital Studios
Super special thanks to the following Patreon patrons for helping make Eons possible:
Michael Roy, John H. Austin, Jr., Kate Huhmann, Alex Hackman, Tyler Adams, Amanda Ward, Stephen Patterson, Mark Foster, Karen Farrell, Trevor Long, Raphael Haase, daniel blankstein, Roberto Adrian Ramirez Flores, Jason Rostoker, Jonathan Rust, Avery Sanford, Mary Tevington, Bart & Elke van Iersel - De Jong, William Craig II, James Dowling-Healey, Irene Wood, Derek Helling, WilCatRhClPPh33, Mark Talbott-Williams, Nomi Alchin, Duane Westhoff, Hillary Ryde-Collins, Yu Mei, 4th_phase, Jayme Coyle, Ben Cooper, Albert Folsom, Oscar Amoros Huguet, Patrick Wells, Matt Parker, Jerrit Erickson, MissyElliottSmith, Stefan Weber, Dan Caffee, Merri Snaidman, Gabriel Cortez, Stephanie Tan, Marcus Lejon, Nick Ryhajlo, Sean Dennis, Betsy Radley, Anthony, Philip Slingerland, John Vanek, Eric Vonk, Jon Monteiro, James Bording, Miles Chaston, Michael McClellan, Jeff Graham, Daisuke Goto, Gregory Kintz, Chandler Bass, Tsee Lee, Robert Hill.
If you'd like to support the channel, head over to / eons and pledge for some cool rewards!
Want to follow Eons elsewhere on the internet?
Facebook - / eonsshow
Twitter - / eonsshow
Instagram - / eonsshow
References: docs.google.com/document/d/1b... - บันเทิง
![[TH] VCT Masters Shanghai Swiss Stage DAY 5 // FPX vs TH | FUT vs LEV](http://i.ytimg.com/vi/r61uDZTmu44/mqdefault.jpg)
![CAMPปลิ้น | EP.75[2/2] คุยแบบนี้แล้วจะจบกี่โมงพ่ะย่ะค่ะ!!!](http://i.ytimg.com/vi/N6E8njWH7Zg/mqdefault.jpg)
Hey Eons fans! We wanted to clarify something in this video that’s pretty important to the process of science: peer-review. The 2016 study about the damage on Lucy’s bones went through the process of peer-review before it was published in a scientific journal, which means that experts in the field were given the opportunity to evaluate everything from its introduction to its methods, data, and conclusions before it was accepted for publication. Toward the end of the video, we quoted some other paleoanthropologists who disagreed with the authors of the 2016 study and spoke about their disagreements to the press. We want to make sure to clarify that remarks to the press shouldn’t be given the same weight as peer-reviewed scientific literature.
This is why you guys are tye best...no matter how old the video is you guys will make sure to pin updated scientific information!
As a child I was a tree dweller. Trees, bridges, houses, playground toys, fences... you name it, I climbed it and sat on top of it. Lucy doesn't need to be full tree dwelling species to fall out of a tree
Was it the down syndrome? Seems like you got yourself a heavy case of it.
Exactly, i m 25, and i still love climbing trees. It comes very natural to me. I don't think we need to be a full time tree climber species to spend some time on tree.
Same here! I would climb trees as high as I could and just sit up there. I’d let ants crawl on me as I tried to become one with nature. 😅
I was a "tree dweller". Lol u climbed trees dude that's it.
@lloydymk2013 exactly 😂. It's not like they were just "having fun"or anything. When u were dwelling on trees u didn't have to anticipate all the time about getting eaten by an apex predator
Since these lived on the savanna, trees would be emergency exits for our ancestors. I would expect that the upper body would reflect that this was useful for a long time.
I was thinking of how some predators put their catch up in trees, so another option could be falling out of a tree but postmortem, she'd already be dead but the bones would still break freshly. I guess depending on how long she was up there probably would affect it, so I'm thinking not long after.
One guy I saw suggested early humans would stone animals to death. Humans are social even early ones. A group of 10-20 hominids throwing stones will deter predators no tree needed.
Two things to support this is it dovetails into early tool creation which is just throwing one rock at another rock and making use of the one that broke with an edge.
The other is that every little kid I know likes to pick up and throw rocks even as their parents try to deter them. It’s an instinctual behavior because no one is teaching them and parents usually discourages the behavior. Something like that ingrained should stretch pretty far back.
Maybe you should worry about cleaning the skid marks and sea men stains out of your drawers first boy!
@@jennyanydots2389 “sea men”
Ahhh another ignoramus. Go and read a book.
A few of our fellow humans still demonstrate truly amazing skills for climbing trees, cliffs and other things.
Bro, that's races. Why do you gotta post stuff like that? Being races ain't cool son. I think you should apologize.
I just shattered my left proximal humeral head, and broke the shaft as well. Odd timing with this video. I feel bad for Lucy. It's agony. She must've suffered a lot.
I'm so sorry to hear about your injury Matthew.
I hope you heal well and quickly.
Get well soon Mathew
I dislocated my left shoulder three months ago - I’d rather urinate shards of glass than do it again…
Oh i dont think she suffered at all, she probably died on the spot.
Sorry to hear it. But Lucy clearly did not die from a fall, it was poor science (actually, it wasn't even Science, it was marketing for publicity).
When he mentioned how Lucy was 1m tall, it reminded me of how small the skulls of our ancestors were when I saw them all side by side in a museum. It is such bizarre thing to see up close - a skull of a grown human that can easily fit on the palm of a hand. Imagine them side by side with some of the larger animals of that time. Or rather, imagine encountering a human species like that today, somewhere in the wilderness. It would probably feel like encountering extraterrestrial.
If you imagine them a little bit like dwarves it is not so shocking... but I wonder how smart they were
@@hatsuharuboi maybe similar in intelligence to a clever chimpanzee?
@@hatsuharuboi Less like dwarves, more like goblins.
Imagine them encountering a smartphone-toting modern human. We would be like gods to them.
@@skaldlouiscyphre2453 Less like dwarves or goblins more like the children of the forest from a song of ice and fire
One of the authors of that paper came to my university in 2017 and gave a couple talks. Basically, he did scaled up the size of Lucy's arm to match human proportions, did a 3D print of it, and took it to sports doctors and surgeons to see what they thought the cause of the fracture was. They all said it was a fall from height. And then one of the surgeons added that he thinks he could fix it. lol
I think it's extremely likely that A afarensis likely still climbed trees regularly - whether to reach fruit, escape from predators, or sleep for the night. And given most of their predators in the savanna likely didn't climb trees all that well, sleeping in trees was probably the safest place to kip down for the night - esp if they didn't have fire (and there's no indication that A afarensis used fire).
It's very reasonable to think that until the adoption and widespread use of fire, our ancestors likely still retreated to the trees at night if they were available.
Your "university"? You mean the local group daycare for severely mentally handicapped adults? Is that what you really meant to say?
@@jennyanydots2389 It's time for your meds.
@@caitolent I'm am a med. I am primarily taken anally but can also be ingested orally. If you apologize to me right now I might give you some boy.
@@speurtighearnamacterik8230 I didn't say she had been treed by a predator. However, we know that A afarensis was often prey for large predators - we've found plenty of examples of them having been killed and eaten by large predators. Was that what happened to Lucy? There's no evidence to indicate that's the case.
As for most animals being afraid of humans? What about it? A afarensis wasn't a human. Nor do we have any indication that they hunted other animals. Did they mob predators when in large groups? Most likely. Do we have evidence of that? No, nor are we likely to get evidence of that. That's pure speculation based on modern species' behavior.
Today, Chimpanzees will often sleep in trees when they're available. And they're a lot bigger and probably stronger than A afarensis was.
I also pointed out that they probably continued to climb trees to pick fruit - which is also something chimps do regularly.
As for caves, there doesn't tend to be a lot of caves in open savanna. Just saying.
Basically, my point is that there's a lot of reasons Lucy might have been in a tree. The idea that A afarensis was still climbing trees regularly is hardly far-fetched.
@@jennyanydots2389 wrong comrade
Even today, people especially kids love or like the idea of climbing in trees. So i wouldn't be surprised if people of Lucy's time despite already being upright walkers would chill in the trees still from time to time.
@Boiling Water on the Stove - Perhaps trying to catch a breeze in a shady tree on a hot day.
You didn't come from an ape like ancestors. It's a theory, speculation. No one has ever observed this.
@@GodSoLoved.Yeshua That's not how evolution works. And we are ouselves apes, so our ancestors have to be ape like.
It's observable in our DNA for one@@GodSoLoved.Yeshua
@@GodSoLoved.Yeshua DNA evidence proves it's true.
Perhaps Lucy, assuming her species did climb trees, did so to get some fruit; or maybe to try and escape a predator and slipped or potentially even got thrown off
You can climb trees to get a look around and get startled and slip, falling to your death
Another possibility that occurred to me is that she was carried up a tree by a predator or scavenger, her lifeless body then falling from that height and fracturing. This doesn't seem likely, because there would probably be evidence of such predation preserved in the bones, but I did consider it as another potential explanation.
@@barrymoore4470 Following that it is also possible that she fell after being attacked by a predator. In Africa there is an eagle that will attack and eat humans, especially small children and babies unattended. And ancient eagle/hawk could have made her fall from the tree to the ground
@@barrymoore4470 Well, fruit is the best explenation for adults to climb trees today.
@@sohopedeco Fruits and honey, some african people climb trees to harvest honey from beehives ^^
Honey. Fruit. Predator. There's 100 reasons she might have been in a tree. Doesn't mean she was there all day.
Fun even. Many people forget that some species have ALOT of leisure time.
Or she was murdered and pushed off
@@octipuscrime Just a bit cynical there. LOL. Not unheard of amongst chimps though.
But everything changed when the fruit nation attacked.
But what if she was there all night?
If a predator was chasing me, I'd climb a tree to escape. Especially if I was only little. Would future scientists think I lived in trees, because I fell out of the one I was hiding in?
The point is: you could do that, but a zebra could? So, Lucy could climb a tree as you can, and that is important. There are lots of cultures, especially hunter-gatherers, that climbing trees is very important to survival to this day.
How efficiently could you scale a tree trunk? That’s the difference- the Australopithecines retained features that would’ve allowed for nimble and efficient climbing. It’s likely that they climbed trees habitually in search of food, as well as for safely. Similar to modern chimpanzees!
Deer hunters spend a lot of time in trees. They even have special tools to make it easier.
But, one individual climbing a tree when alone doesn’t really tell much about a social individual.
What would you do if a predator approached you and six adult male friends?
What would you do if you were attacked by a predator and your wife and child were with you?
What happens if you and your six buddies were there and their wives and children too?
My guess is in many cases the predator sees too much risk and leaves.
There is one more reason predators don’t usually like hunting humans. We punch them in the face and gouge out their eyes. Humans might die but many times can seriously injure a predator with just fingers and fists. How far back were hominids doing that?
@@luizffortes, imagine all the ways people could die and their bodies not recovered, and what kind of conclusions future scientists could come to.
Or if you went up the tree to get better fruit? I used to climb until my 30s, no gear, to get the best fruit out of apple trees. So.... I don't live in one, but I sure do climb 'em.
I wish I had income enough to become a patron and have it be listed “In Memory of Steve”, a man I never knew, but miss.
Interesting that the scientists couldn't tell the damage happened after fossilization. I would have thought there were big differences between a fresh bone break and a rock breaking.
Well, it stays bone for a long time, but your point is taken.
You have to remember, when an animal dies, it doesn't get covered in dirt immediately. Decomposition happens, which attracts predators and scavengers, which moves and crush bones; that is why a complete fossil is so rare.
Definitely a mineral fossil break would be different than bone break right?
Breaks that the organism survived are obvious. Breaks that resulted in death, less so.
@@highfive7689 not a pro, but that seems to be right
I used to talk about (a replica of) Lucy when I was a museum tour guide, I always like learning more about her
What the are the odds stumbling on Lucy? Can you imagine how many fossils are out there that we haven’t discovered yet that would answer so many questions.
You're a thoughtful person. :)
Can we be ABSOLUTELY SURE that rhinos didn't fall out of trees back then?
Great episode, I love your summary on this topic. Wish we had a time machine!
I recently saw Lucy at the Cleveland Museum of Natural History and it was incredible to see the remains of every humans’ ancestor. I highly recommend visiting the museum if you are able to
Just... Wow!
That's just a plaster recreation. The fossil is in the National Museum of Ethiopia. It's not even on display there.
@@_Opal_Miner_ you sure the British didn't take it to London? Oh, wait it was discovered in the 70's. Had it been discovered in 30's they would have shipped her long before people could come up with a name
It doesn't matter if it was a model of Lucy or not. To be looking at our famous distant relative would be a very cool experience. And quite humbling.
Modern humans think they have it tough. Its virtually impossible to imagine how Lucy and her family group lived and the hardships they faced.
There's no proof she was a direct ancestor , she could have been a distant cousin.
I was compelled to give a Phillip J. Fry "I get it!" on the "we still love Lucy" line. They really like giving you the wordplay lines.
A very interesting hypothesis, it's really too bad that behaviors don't fossilize. So inconvenient, haha!
And I still love how Blake can't help but giggle about the silly word-play at the end of each video. It's great.
Maybe we'll find some old video tapes.
I might just be an armchair archaeologist (or paleontologist), but it makes complete common sense to me that a hominid that small as an adult would spend time in trees just from a safety standpoint. There's a lot you can get away from by climbing.
Hominids travel in big groups and quickly learned to throw rocks at things. I don’t think spending time in trees was that necessary.
This wasn’t likely a singular animal that lived alone.
@@jeremymullens7167 you’re really motivated to share your opinion on this, I’ve seen about 4 comments so far. Idk about you but if me and 10 of my mates ran into a tiger, I don’t think the go-to would be throwing stones. Humans definitely did get eaten by other animals, we’ve got so much evidence to support that.
The fact that WE as humans sometimes climb trees NOW, tells me that Lucy, her kind and beyond climbed trees too, sometimes to get away from predators, but also maybe to just see the path ahead of them! But also they may have still slept in trees, since it would be safer then sleeping on the ground!
I mean a lot of humans of today do these same things, so before it was brought up that other animals had some of the same breaks in her aria, I just imagined she had climbed up into a tree to get away from something trying to eat her and maybe she was so scared she slipped and fell out! It's not out of the realm of possibilities, so she could have died that way, still!
The way that you guys present this show is awesome. Congratilations for all the team!
I agree completely.
I like all of the presenters!
That Lucy mostly walked didn't mean she didn't climb trees. Hell, modern humans climb trees. And there is lots of evidence that humans have often climbed trees in the face of carnivores.
It is a safe place from ground stuck predators humans instinctively I think see trees as an escape and hide card you could be very very right!
But again that doesn’t mean it was from a tree it could’ve simply been the ground
The graphic at 3:08 of the great rift valley being the main places we've found Australopithecus makes me wonder where else they are in the fossil record.
Modern humans still climb trees to reach safety. There are so many reasons for her to have been in a tree that don’t involve regular day to day activities. Maybe there was some delicious fruit in that tree.
@Andrew G
This video bugged me a little bit because it didn’t say anything.
@@dffndjdjd I’m making the comment in response to scientists trying to jump to conclusions about how an ancient human that supposedly walked in the ground could have fallen from a tree. Whether or not Lucy fell from a tree, when shouldn’t assume that ancient humans didn’t climb trees. We climb trees and fall out of them in 2022. I’m pretty sure you can go back every single year in the history of humanity and find at least one person who fell out of a tree. That doesn’t really say anything about human culture or habits. It’s just one of the things we do as clumsy apes.
The title is “How did Lucy live and die?”
The conclusion was “we don’t know”. It took me right back to where I started and why I clicked the video. In this case it debunked information it presented and did not add further to the subject.
If the title is was more about the debate and less “click baity” I probably wouldn’t have been as annoyed.
Sure it presented a debate on the life and death of Lucy. But the debate was the subject of the video not Lucy.
I think what I’ve seen a lot is this: Humans can climb trees therefore Lucy could climb trees. Which makes the whole debate rather silly without more information.
What the scientists are trying to know though is did Lucy spend a large part of her life in trees. Which is different.
If Lucy falling from a tree had held up, it may have been a starting point. More tree falling injuries could be found or we could use the information to form an hypothesis and look for supporting evidence.
The conclusion puts into question the fall but, it’s reasonable to assume ALL human species COULD climb trees. The question becomes how necessary we’re trees to Lucy’s life style?
Wouldn't you figure , being so small she might need to hide in a tree 🤔 I bet Lucy never thought she would be the topic of Debate literally Eons from her Birth 💝
Not literaly eons, because she lived relatively very close to us in the Phanerozoic eon. It started more than 500 million years ago.
@@sohopedeco - Vernacular eons.
Everyone : How did she die?
Paleontologists: She monke fliped...
Imagine that Lucy was the weird one who just liked climbing trees when her species didn't really do that and we're trying to judge whether or not they did based on one strange person😂
@Alla Sperans - Or one playful person. Was she after a bird's nest, ripe fruit, a pretty butterfly, playing hide & seek?
@@MossyMozart Well then that would be very cruel.. It is amazing how she could just be playing freely, but so devastating how that would lead her to her death.. she didn't deserve it
This channel always brings something interesting! Nice vídeo!
"We still love Lucy."
Blake has some 'splainin' to do for that pun.
I've really wanted to see a modern documentary about hominids and all the creatures they lived alongside. I've seen many hominid documentaries when I was little kid and with new rise in paleo media, I hope one day we can have it.
I'm sure you've already seen Alice Roberts' Incredible Human Journey, but it does touch on these things. But I agree, those types of documentaries largely focus on the anatomical aspects of human/hominid evolution whilst somehow also avoiding describing the driving forces of evolution over time (i.e. predators, competition from or territory shared with non-predators, environment, food sources, "human" activities like tools and fire, potential behaviours as a result of these factors). I suppose it's difficult to accurately and confidently assess them given the time span. I'd love recommendations for docs or books which cover these factors as well as changes to anatomy over time, either with individual case studies and broader descriptions over time and location (or both!)
@@batll0 I'm just saying that I want a hominid documentary that also focuses on the other fauna of Pliocene Africa.
Consider this: African animals have an instinctual fear of humans. Animals outside Africa don’t always show that fear. There should be a way to clock the time needed to cause that behavior.
I don’t think predation was a big factor in human evolution. Humans moved in large groups and could throw rocks. The most likely thing killing humans then is probably the same as now: other humans.
One way to look at it is, if she died falling from a tree, perhaps she wasn't so well adapted to being in them after all.
Maybe, unless the branch just broke. I used to foster baby squirrels and they were of course incredibly agile on branches, but I once left a loose branch sideways across the top of our deck railing, and teen squirrel jumped on the end without noticing it was not attached to any thing, and both it and the branch fell off the of the deck. It was fine, but showed even squirrels aren’t great at spotting unstable branches,,,,or at least the younger ones aren’t.
Serves her right for treating Charlie Brown and Linus so badly all those years.
Nostalgia tour with Hank and Steve narrating Eons, great Xmas gift to.viewers, thank you both.
Even after decades of reruns, too! We still love Lucy.
I think the question "how much time they spend on trees" is more interesting that if they spent time in trees.
Humans can climb trees and will spend some time in it, and we've lost all our adaptations to do that, it would be very strange that one of our ancestors who kept some of these adaptations never climbed trees ^^'
We have retained many adaptations for climbing trees. Two that I can think of are grasping hands and forward facing eyes to help with branch distances.
Sure our hands don’t have the curved fingers of other tree dwellers but compare human anatomy with dog anatomy.
Those tree climbing traits gave us a head start to grasping tools.
@@jeremymullens7167 True, but our grasping hands can be used for a lot more things than just climbing in trees, and cats don't need grasping hands for climbing in trees ^^
As for forward facing eyes, dogs have it too, it's useful for moving in trees, but also for predation, and we use them for predation a lot more ^^
Once again I'm reminded of the Quest for Fire movie scene where the two early ground-dwelling humans escape the large cat by climbing a tree.
Was that a movie from 1980?
@@alicecain4851 yes (1981 actually). It had, among others, Ron Perlman & Rae Dawn Chong in it. Completely non-scientific, but a fun watch anyway.
Was that the cartoon one? That’s like heavy metal?
When I was a kid, my friends and I would climb tree's for fun. We fell plenty of times, thankfully we never broke anything. I could see something similar happening to our ancestors. I mean, they didn't have a playground they could go to. lol
This video is just in time for my biology lesson on the origin of humans. We just started talking about Lucy.
Thanks for the consistently amazing content!
if you would like some more deep dive. Real Science is running a seperate series fully dedicated on the origin of humans.
It might be only on Nebula but if it's for teaching purpose. maybe very interesting.
I didn't know they taught individuals with such heavy down syndrome things like that. I mean, your down syndrome is so heavy shouldn't you be focused on learning more practical things for yourself? To be honest I'm shocked you can read and type words on the computer. It's truly amazing and something you should be very proud of boy.
I like thinking about how someone we know named Kyle could fall out of a tree
Be discovered thousands of years later
And they name him something else and his skeletons famous lol
In this case, millions of years!
Makes you want to wear a really well wearing name tag.
@@alicecain4851 dang I read this earlier today and I can’t stop thinking about that
It’s hard to remember sometimes that, when we look at human fossils, we’re looking at the remains of our fellow people, and should treat inquiries into their causes of death with the same respect and gravity that we would the death of a contemporary.
Are there any common wear patters on joints of tree climbers that we can compare these fossils to? Also, is there any evidence of cliffs or valleys in the area at the time that animals may have fallen into?
You sound like a races boy!
I was excited to see hank, very sad he was only there for the intro
Given that Lucy was a fairly early biped, lived off the land and was vulnerable to predators the biggest surprise would be if they didn't climb trees.
I haven't finished this video yet, but even know one thing that connects children all over the world is their love for climbing. I could definitely see that children were taught to stay in the trees while parents did work on the ground in order to keep them safe
I went through a phase when I was a teenager where I climbed a lot of trees with my friend just for the hell of it. I could have fallen and died from some of the really tall ones. I’m probably lucky to be alive lol. Anyway. Lucy could have just been randomly climbing a tree for the hell of it.
Thank you for another fantastic video eons!
I think it says a lot that we still find trees beautiful and put them even in cities where it's not particularly practical to have them even before we understood that they help air quality
We still sleep in beds elevated off the ground even after we finally left the trees. It’s the one instinct that makes humans feel safe. Sleeping on the ground is a death warrant. Until relatively recently, hominids only spent time on the ground to gather food and scout out their surroundings. At night though, they would retreat to the safety of the trees to be out of the reach of predators. A trait hominids share with chimpanzees and gorillas who split off from them later.
yaayyy! I love the Eons & podcast episodes on hominin ancestors/offshoots! (i love all the Eons, but somehow these episodes strike a very deep chord with me and I feel resonance with them. The podcast ep on homo naledi moves me so much I've listened to it at least 30 times
also BLOOPERS!!!! :D
Why might that be a big deal? One thing to keep in mind is, back then, when Lucy was newly discovered, walking was considered a "modern trait"... people might have been biased against the idea of Lucy being on the ground, but today we're comfortable with the idea of humans and our ancestors climbing trees or being in the ground accordingly.
0:18 looove that frame 😂
I just love Hank narrating, especially the way he does it on Journey To The Microcosmos. Hope to hear more from him. Nothing against this presenter, he is formidable, too.
I haye his voice.
Lucy on the tree with diamonds :)
Always learning more! Loved it
I know I've said this before on another video, but it's just surreal and wonderful to be able to watch PBS again, given that PBS Kids was my childhood more than Disney, Nickelodeon or even arguably Cartoon Network (Though Ninjago does complicate that) ever were.
This gentleman is one of the best narrators
*Perfect* timing. I was just scrolling looking for something to watch 🥰
Nobody:
Lucy: *sing with me, sing for the year*
Fascinating! I was hoping you could do a video on the evolution/purpose of sleep sometime, I'm really interested in learning about that topic!
I seem to remember a hole in her skull. There was speculation that she was killed by a big cat and hauled into the tree for safe keeping.
Personal I’m doubtful Lucy died from falling out of a tree,simply because her remains were so well preserved. If she died from a fall on the African Savana her body would have quickly been consumed by scavengers and her bones scattered . However she died her remains must have been covered very quickly to preserve her skeleton as well as it is -possibly a flash flood or mudslide killed her. This would also account for the broken bones as well.
Finally someone that thinks! Definitely truth in what you say! That's why you cant always believe the storytelling that accompanies some of these finds.
Imagine you’re one of the first and you still can’t escape your embarrassing moment being talked about millions of years later
If true that’s poetry in nature. The oldest ”human” we found is one who fell out of a tree. One who mightve lived if it was still ape (ik we are still apes, don’t get technical on me, im simply a symbolic poet)
Lucy's Fall is the name of my Beatles ska fusion cover band.
Thanks for the info, it is very important that people know this.
Charlie finally got tired of her pulling the football away.
At the start I thought you were going to say that she didn't climb because a leopard took her up into the tree. It's a possibility. Has anyone studied how often, if at all leopard kills fall out of trees?
Wouldn’t it have bite marks if she did get killed by a leopard?
@@jonathan_narain1189 Yes but there's a lot of the skeleton missing.
John Lennon was inspired by his son Julian to write the song Lucy from a drawing, about his playmate from school.
Well, that a whole lot of drugs.
*L*ucy in the
*S*ky with
*D*iamonds
That's the urban legend story
I thought he was talking about LSD
always love the bloopers/behind the scenes 😆
Another great episode!
That was really interesting great video!
Lol Cher on the battleship was EPIC.
Being an obligate biped doesn't mean living on the ground, look at gibbons. Also, living largely on the ground doesn't mean being an obligate biped, just look at panins and gorillas which both have their own uniquely evolved knuckle walking morphology which both seem to be more of an adaptation than bipedalism/upright posture which was more common in extinct tree climbing apes than in modern tree climbing apes. My point is that it seems our posture may not have changed as much as is popularly believed as we left the trees and other great apes' mode of terrestrial locomotion seems to be quite an adaptation. The tendency to predict the opposite with the limited evidence we have seems to me to be at least partially based on the bias of assuming that becoming human requires a higher degree of adaptation than becoming gorilla or chimp/bonobo.
Lucy dared venture outside her tree and died, then her family came down for her and decided to stay down so no one ever falls to death again
This is a great example of why I get frustrated with science coverage in the mainstream news.
They make headlines with stories that are just a hypothesis, and then report it as fact.
Or the same thing with correlative studies. Where the need reports a headline like " scientists discover _____ causes _____."
And that's usually not the case.
Usually it's just that they discovered a correlation in a small sample size, that warrants more studies, to see if the correlation is actually meaningful.
0:27 how did the scientists find out from which hight she fell?
I think it’s just an estimation based on some assumptions: if we assume she was in freefall, had normal bone strength, and that the fractures used for this calculation infact were a result of the fall, we can calculate an estimated energy needed to break those bones.
And if you know a needed enegy and a mass of an object, you can calculate how long it takes in seconds to reach that energy in freefall. And then you can convert that time to distance of the fall.
That said, there are a lot of variables and assumptions hidden in a statement like that. The scientist only know the force of the impact if we assume their modelling is correct.
By making some educated guesses about how big a fall would make that much damage. But as the vid points out, there are other possibilities why the bones are broken, so the idea she fell at all is still up in the air (sic).
@@catcatcatcatcatcatcatcatcatca thanks
I got your calendar, can’t wait to use it
If I had to guess, I'd say bipedalism came first, when we entered the grasslands, then followed quickly by freed up hands for tool use, which started a big brain - better tool - bigger brain cycle.
Edit: with tree climbing ability partially retained to escape predators or gather fruit.
Without watching , I'm guessing she pulled the football away one too many times and Charlie Brown snapped.
Lucy’s baby skull will now forever live in my nightmares
We just keep hearing a "a lot of fractures" and then the ones listed are both hands, both wrists, both arms, a shoulder and the jaw. If it was caused by the effects of fossilization, shouldn't the fractures be essentially evenly distributed in the skeleton? So are there similar fractures in the legs/pelvis/spine, or not?
The bones aren’t an even thickness.
Why should we assume forces and pressures happened evenly across the whole fossil?
I’m not saying it’s not the case. I’d just like to point out there’s probably a lot going on that might be hard to account for.
climbing such an incredibly tall tree would be strange if she wasnt used to or well versed in climbing. maybe she was trying to get away from something, climbed the tree, and accidentally fell when the creature left and she was trying to get down? i hope she didn't suffer for long. rest in peace, little girl 💗
One part to always look forward to in these videos are the jokes. Amazing, haha.
OMG HANK ON EONS! HEY FRIEND! Long time no see you on here
Or maybe this day she climbed the wrong tree…maybe the branch was already about to give out
Maybe they walked along level tree branches and used their arms to hold the branches above them to steady themselves?
I love how tickled he always gets from the horrible, horrible jokes they make him read.
Everytime I watch one of these stories about the diversity of species and possible lifestyles of our distant ancestors, I can't help but feel a bit lonely and unnerved at the fact that we are the last of the hominid lineage. We will never encounter a different homo species to learn and be wowed anymore. All we will ever have is bones and conjectures.
I think we bred them out of existence. Some of us still have Neanderthal DNA.
Great video guys over at pbs eons!👍
GET WELL, HANK!
Praying for you.
Doesn't it make sense that at night, for safety, they would sleep in the trees? How many predators are deleted by Lucy sleeping up high?
This is definitely the best existing channel on TH-cam!
Then you would like "Nova" and "National Geographic" too.
What stands out to me was that the fractures show that (if she really did fall out of a tree) she put her arms out. Meaning she was trying to protect herself.
That shows fear, caution, and those are evidence of the evolution of cognitive ability. How many apes are “afraid” to fall out of a tree? Apes can swing from tree to tree relying on their arm strength, comfort, and natural instincts. Why was Lucy afraid? Because of her cognitive advancement.
Maybe it's exactly because of this transition to bipedalism that she fell from the tree.
Legs to walk are less adapted to climb trees.
It is possible that many of our evolving ancestors caught between the two worlds of bipedalism and living in trees ended up dying from falls, speeding up the transition to bipedalism through natural selection.
I feel like for a tiny hominin like that, it would have been deadly to not be in the trees part of the time. There were so many huge predators and other large animals that could be dangerous that especially without fire technology, it would have been impossible to survive without being able to get up into the trees.
What is mesmerizing that no predators, or scavenger dispersed the complete body. Looks like small ones take a bite here-there.
As a rock climber I don't think it's far fetched to assume we never stopped climbing around.
When you are that small you would certainly use the safety of trees on a regular basis.
Tbf, some modern humans can climb trees really well. Can't be too hard to an Australopithecus to climb trees if there was food or if they wanted to escape