Google Dr. Barry Marshall, he was so confident in his hypothesis that a bacteria he had cultured caused stomach ulcers directly that he drank some, developed ulcers, then successfully cured them with antibiotics.
In that case he had discovered the bacteria in otherwise healthy ulcer patients. So he knew going into it that his worst case scenario was being right and getting temporary stomach ulcers, whereas in this case he had a non-negligable risk of cancer and/or painful death
If you’re at ALL concerned about health, get rid of the cats (toxoplasmosis), toxo is real , and REAL BAD: mild to severe depression, headaches, flu symptoms, nerve twitches, schizophrenia, Parkinson’s, cysts (often misdiagnosed), low vision, eye floaters, detached retina, miscarriage , congenital in cats and humans, 1bil micro eggs hatch from a litter box in a week, eggs can live 2yrs in bleach water and still hatch(Usa navy Oahu research) , cats constantly re-infect themselves , negative tests are inconclusive due to a long dormancy potential, a dormant cyst can outlive the antibodies being tested for, as it waits for a weakened immune system, some people have an immune system that will beat it, no antibodies can also mean it has advanced without a fight, natural and medical treatments exist . Goal of toxo is to re-wire the brain , the litter box doesn’t smell and the cat is the most important thing . In 2 separate studies 85%of motorcycle fatalities test positive for toxo. Many behavior changes. (Dr Flegr) Pregnant women shouldn’t go near a litter-box , cat house , or cat dumpster , actually nobody should. Domestic cats are not native in the USA. Don’t eat undercooked meat or fish . Most vets don’t know enough to advise people.
Might be easier to figure out how termites get the bacteria they have in their gut that do this for them to stay alive in their gut, then apply that to humans.
18 months of lactose tolerance sounds incredible compared to having to take so much lactase. That is so impressive I would love to see it come commercial
as a programmer i'm hella excited about dna and the implications of manipulating it for the better. like, mind me being an agnostic boi, if god exists he's definitely a coder. i love this shit
With the human-compatibility improvements he made on top, I wonder how much more effective it is now EDIT: Wow, he does mention it might last years in the video...
Exactly, I don't see why this can't be considered good enough. Just like we can get a seasonal flu vaccine, we could do the same thing with AAV treatment. They are very easily mass produced anyway.
@@justindie7543 One of the many downsides to an AAV is there's a high chance you produce antibodies against them. So it's a one off and can't be reused most of the time.
@@thethoughtemporium For unrelated reasons I recently learned that immunity to some viruses tends to wear off over about the same timescale. Is this so for AAVs?
@@thethoughtemporium I don't even want this for consuming lots of lactose. Just to stop the advancement of my condition. How did you synthesize this, did you hire a company, or culture it yourself?
@@thethoughtemporium will you try reusing it on yourself to try if you can get it to extend the wear off time? - a try wouldn't hurt i guess? (for the recort: i am just a interested nerd and no expert...)
normal person: oh, I'm lactose intolerant I guess thought emporium: oh, I guess I'll get a degree in genetics, make my own lab and fix my lactose intolerance
@@phillipanselmo8540*TL;DR: becoming lactose intolerant as you age is perfectly normal and shouldn't be seen as a medical condition. It's rather lactose **_tolerant_** adults who should be viewed as weird.* Infantile lactose intolerance is extremely rare. Before the invention of baby formula, that condition would mean certain death to any newborn in short order. In most mammals (as in each one except humans), the production of lactase ceases as they are weaned off of their mother's milk. Humans with lactose intolerance don't have a defect by any means. It just simply means they lack the mutation that allows humans to produce lactase past infancy. Lactose intolerance is rare in Europe and the middle east, as these cultures historically relied on animal milk for survival, but go to China and it's the other way around. Lactose intolerance is the rule, not the exception the gene still exists, perhaps due to crossbreeding with European populations, or perhaps their ancient ancestors had the gene before they arrived in Asia, and later lost it due to the lack of a selective pressure to keep it. Producing the enzyme isn't free of course, so losing the gene frees up energy and resources for other tasks.
This is far more than that. Making your own medicine can be as simple as learning about a few plants and mashing them in a bowl. This guy "home-brewed" a custom virus in order to target and alter his own DnA. It's pretty crazy that such a thing can be done these days.
@@UnknownSquid Yeah, not going to the doctor and making your own medicine is standard fare for a good percentage of Americans. As far as I'm concerned, you aren't a real American unless you've bandaged up a wound that desperately needs stitches, or at least considered buying antibiotics on the dark web.
@@derp195 I still have a big round scar on the inside of my elbow where a gaping hole once was. Probably should have had a couple stitches. Instead got some sterile gauze and a compression wrap. (Thanks mom) Though going back to the scene of the accident and looking at the dried pool of blood that ended its cardiac journey on a patch of asphalt baked in the hot summer sun had a somewhat profound effect on me. At least until it rained. My that was a long sentence.
This right here is the pro of not being depending on a university. You are your own ethic department. Justin: "Am I allowed to do this?" Justin: "Yes, yes I am."
If I had the financial means I would experiment with all kinds of things, even the most tabu... So I think it's safe to assume that all kinds of things happen in the shadows.
Well, experiments on one's self are a proud tradition in medical and scientific community. I don't know ethics boards' guidelines but i wouldn't be surprised if a project like this would be given a pass.
I'm a Biologist who randomly came across your channel today, and I must say..If this is not revolutionary science, I don't know what is! The fact that you went with this whole project is simply mind blowing. I hope that you've collected a shit ton of data, and are willing to back up your claims and help spread the word that Biology, if practiced carefully and with full awareness, can virtually achieve the impossible!!
USA went from a space race and telecommunications revolution to electing a Tangerine for president only to follow up by electing a Narcoleptic president. If we invested money into truly innovative individuals like this we would be so much better off.
@@exodeus7959 Don't worry, that'll never happen, the US population stock is only getting worse by the day, not gonna be having many Edisons and Feynmans anymore lol
What I don’t understand is if this guy can give himself a year of tolerance, how is a pharmaceutical company not making couple thousand per person per a year making a commercial product? Are clinical trials just that expensive? I feel like there must be more to this that I’m not understanding
Of course I have, Humanistics btw. It is essential to do research and especially in cases where human lives are in danger, the video even said that these studies are far away from even being optimal to test in humans, I wasn’t referring to the part of him using himself as subject of course, but the part where he explains the process and new advancements in research.
The sad part is we'd likely be much further alone in gene research if it wasn't for the fact that around 20 years ago when genetics was just fully ramping up it was utterly shut down because of bible thumpers crying out because it's playing god, SO here in the US, the only research being done is by the private sectors so long as they have ZERO government money going to them for research.... So essentially no major collages or any other US based medical company can touch genetic research..
As someone who worked in a lab at Johnson & Johnson -- You are amazing. I wish this form of open crowdsourced pharma research was more common. I know most people see "big pharma" as evil. I think it's a double edged sword, there will always be a need for proprietary R&D backed by deep pockets. But the closed source software dominance has been balanced out by open source. There are still a lot of closed products, but the open source community is thriving as never before. I have a feeling this revolution could just as well happen for pharma R&D.
Actually there such a thing. A local hacker space that I'm a part of does just this . If you look into I'm sure you'll find exactly what you are wanting.
Bayer CEO: *starts sweating profusely as he sees a chance for profit wasted by creative commons* Joke aside, outstanding work! Glad to hear there's still pizza in your life.
@@RubenKelevra In principle, yes, but nobody is going to go through the process of getting this sort of treatment FDA approved without a government enforced monopoly to let them charge exorbitant amounts of money that render it exclusive to the outrageously rich.
@@Plotatothewondercat You can't really win either way. Look at how many people died with stomach ulsters, believing it was stress when it was actually bacteria, and that was due to it not being profitable to test due to not being able to make a large profit selling penicillin. A guy down here cured his wife of MS with penicillin - it cleared a bacteria blocking blood flow in her brain -, but no one will test it as there is no money in it. Big Pharma - also the record industry, lol - are all about exploitation. They say it costs a trillion to develop a drug, yet the pay students with an idea $9000/year for 3 years to see if they can make their idea work. I bet all that investment is also tax deductible.
Some thoughts as a previous synthetic bio researcher: A downside of AAV therapy is that the human immune system learns to recognize the specific virus, meaning that a person won't likely be able to receive gene therapy using the same viral carrier more than once. Though there are a number of adeno viruses species we can use, it isn't unlimited. A lack of thorough documentation of who's been infected with what further complicates the issue. There's also the possibility of an overreactive immune response as well. Working in silico on Benchling is a fun and interesting way to learn about DNA and gene functions, but wetlab experience will show that synthesizing such a plasmid will be difficult as described. Like the CRISPR plasmids more commonly made these days, their large size makes them difficult for bacteria to replicate and opens room for unforeseen genetic regulatory error and problems--not all that are well documented. Scientific literacy is always worthwhile to pursue, but some members of the public can learn to curb their enthusiasm as they discover the nuts and bolts of the actual process.
As someone with no knowledge of biology beyond what little I remember from high school, the idea that popping a pill is something that can literally change your DNA is hard to wrap my head around, kudos to you for actually being able to do that
I wonder if it can work for physical conditions. Could it cure bilateral club foot? I mean my feet had to be completely reconstructed from the ground up. Bilateral club foot is actually quite easy to treat at a young age, just that I think my doctor messed something up or I didn’t wear the feet aligners enough and I ended up with messed up feet for my entire life. Or maybe this could be a real cure to autism. Then again curing autism sounds like something that would kill you metaphysically. Like you’d still be there but your personality and what makes you you would be so irreversibly changed you’re basically dead. Asthma could however be something this could easily treat.
@therealspeedwagon1451 autism isn't really something to cure, personally (as an autist) I massively dislike the idea of autism being a disease. most of us are just a bit different, and the incredibly low functioning autists will 99% of the time have other more severe issues that directly contribute to their disability more than autism
@@friendlysnoworb6091 Yes, there are aspects of it that could potentially benefit from a cure, but keep in mind that humans have extremely poor judgment when it comes to things like that. I'd love to know when I'm thirsty before I'm significantly dehydrated, but curing it would change me into somebody else entirely and much of the issues either have workarounds or are the result of society just not being set up for us.
@@friendlysnoworb6091I mean personally if I could press a button to make it go away I wouldn’t even need to think about the decision. Yeah, maybe the unpleasantness of having it is a result of society not adapting to it. Who cares though? I don’t see it changing, neurotypical people have a kind of instinctual revulsion against those who are different. I don’t care why it’s unpleasant, I just know it is.
I'd rather not have autism but the idea that it's remotely curable after you turn like two years old is ridiculous. Most of the effects that suck can be modulated with, for example, oxytocin, tho there isn't really research into administering it for tamping down the worse parts of having a developmental disorder
@Joe Alexander sounds like a too complecated procedure for a small benefit,also further down the line if some other thing takes advantage of this loop hole you put in the body will put the person at risk won't it?
This is amazing. You’re showing me that my childhood dream of having my own little “dexter’s lab” at home is possible. I’d actually love it if you made videos instructing how to set up and run your own lab for different experiments along with the costs, licenses and training needed for any of the equipment.
@@alextell7019 Oh, of course. I'm assuming that I'd need real-world, hands-on training. The video would instruct on what kind of training I'd need among other things. Makes sense, right?
same boat as you, I also obtained an egg alergy at the same time because I ate almost nothing but eggs when I had the intestinal infection. warning to everybody stay away from eggs when you have an strong immune response in your digestive system because your body has a decent chance of getting mad at the proteins in eggs forever.
@@Slekejkwls-1819 2003. The human genome project ended in 2003 after more than a decade of groundbreaking work. I think it's even more amazing to say that a task which 20 years ago took us 13 years, billions of dollars, and the greatest minds the field of genetics had to offer to can now be accomplished by any random bloke equiped with the internet and a cup of coffee at his kitchen table. Having a technology mature and progress so rapidly is remarkably rare. It can be compared to the rapid development of aircraft in the first half of the 20th century, and the exponential growth of both the quantity and quality of digital computers from the 70's until the late 2000's
It warms my heart to see that this kind of science is still out there. You, sir, are the kind of person that motivates the hell out of me. I had rejected a PhD offer because I was kind of disillusioned by the current state of accademia but you've inspired me to reconsider it.
That is all fine and dandy and can probably help people with a lot of issues, but I feel like that can very easily lead to human chimeras that can very well lead to a far more difficult life, simply because playing with your genome is so unpredictable.
"Please don't test this on yourself" Me: There has been tremendous pressure to regulate this plasmid business. There have been side effects: blindness, insanity, death. But what use is our ideology if it is not tested?
Wow this is really interesting. I have a doctorate in an area of health science and my B.S. is in Biology. I'd would NEVER have the "guts" to mess with this type of experimentation. I'm completely impressed and totally horrified by this lol
1) Man your such a good guy. So freakin cool 2) When something like this eventually reaches mass production they will have to be vary careful to remove/neutralize/break down the penicillin. We don't want any super-resistant bacteria to form after all.
this is amazing! i just discovered your channel and i'm so eager to watch more about genetics. i'm a huge bio nerd, mainly because i have a rare metabolic syndrome and i like learning how it all works. awesome stuff!
I wanted to repeat your experiment, but with alpha galactosidase, to cure my ibs, but then I started making my own kefir, and that totally cured my ibs. All it was just a gut disbyosis.
@@DanielSMatthews why can't we engineer a probiotic that can make enough lactase for our needs then we have all the benefits of gene theropy without changing your own stuff
@@ChrisD4335 We are full of microbes that produce lactase. That's exactly what lactose intolerance is: gut bacteria digesting the lactose we couldn't digest ourselves.
This is utterly bizarre and mind-blowing! I LOVE the DIY esthetic but never would’ve imagined it could translate to gene editing! This sort of work is so very important because it created a proof of concept so quickly! It would take a big company decades to do this! Bravo! Keep on truckin with yo industry disruption!
Well, theoretically, you should be able to do the same with any enzyme (just assuming you have DNA that encodes something that will produce Vitamin C), but I think doing it with Vitamin C would be more dangerous. With this, the worst that can happen is you have too much lactase in your stomach, which shouldn't really do anything other than digest lactose (I am assuming the only possible failure is over-functioning). If you add something that makes Vitamin C to your body, especially if you let it replicate like this new version is meant to, you could run into problems. If it replicates too much or ends up making you produce too much Vitamin C, you will have too much Vitamin C in your body, which can lead to some serious health problems and eventually cause major damage to organs (more likely if you are consuming too much iron or have other health problems). As far as I know, it would be extremely difficult to remove this DNA sample from wherever you spread it, so unless you have something ready that you know can remove around the same amount of Vitamin C, it could be potentially disastrous.
Technically yes, BUT it's way harder. We're only missing one enzyme in the vit C pathway, but the reaction it does to make the final vit C is kinda narly, so it has to be done in the liver to deal with the free radicals it outputs in the process. But modding a liver is ridiculously hard. The cells just refuse to keep the mod so they almost always fade in less than 6 months and getting the DNA in there in the first place is hard.
Thank you so much for doing this video! I was one of the people that asked about it a few times. Absolutely incredible experiment and I really appreciate the follow-up!
I don't see why the AAV treatment isn't good enough? Having to take a few pills every year instead of every meal is a hell of an improvement. Here's a very simple experiment, try taking the AAV treatment again. Does it still last the same amount of time or will the immune system resist it?
Tobias Fellmann The chance of cancer was mentioned in regards to the new version being more human adapted and designed to hide from the immune system, however he mentioned that it is specifically designed to not integrate into a person's DNA to reduce that chance. Likely the danger does not exist, but as stated, it requires more testing. Do not try on yourself.
As someone who lost lactase production recently, in their early 30s, I am extremely excited about this research and the potential it represents. Here's hoping a commercially-viable solution is available in our lifetimes. I really appreciate the work you've done to move this forward within the community.
I love the idea of open source DNA. That's so cool how much it translates to software. I love the idea of seeing the equivalent of someone finding a "bug" in the code and it being committed to the master
Oh shit! Chitosan sounds like just the thing I need. There's a way to reliably differentiate most cancer cells with no false positives by looking at MR1. I was trying to integrate it into existing T-cells, but now that you mention it, a standalone single use sequence with no integration or replication would be way easier and safer
This is a very cool project. One comment- mammalian cells actually do have many ori sequences- the c-Myc ori has been cloned into plasmids which replicate as episomes in mammalian cells. The SV40 ori works for this too and is the most commonly used.
This video is so cool. I just wanted to clarify something mentioned at the beginning however: *milk is not a waste product.* Research conducted at the Edinburgh University which got information from the Global Academy of Agriculture and Food Security released a study in 2018 that showed that 50% of loss of milk product is from retailers, distributors, and consumers, while the other 47.4% of it is from spoilage and waste at the farm or while the milk is being distributed and exported. Dairy cows are actually an entirely different breed from beef cows, so it's not like milk is a byproduct of anything. Factory farms actively increase or decrease their yield to meet market demand. Overages occur as a result of balancing an equation of production cost and potential revenue from unpredictable shifts in market demand which via markup justifies some loss. It's just a natural result of our on-demand food market systems. So milk really isn't a waste product anymore than any food item is. Thanks again for the video. Gene therapy stuff is so cool.
well they are probably gonna say yes that they cover cancer but when you actually get cancer from gene therapy because of an error then they simply won't pay as always.
@@sontapaa11jokulainen94 how would they know that it was self induced. Like sure if you post online about it, but most people would do so anonymously. AKA don't snitch on yourself.
@@cg4tw855 anything that modifies DNA is typically given a marker to show that it was from a genetically modified source. I assume(since i have not looked at the github section for this yet) that this particular DNA code has that marker in it, and to produce it will need to contain that marker. however if you know what you are doing you could technically remove it but most anyone who knows these processes and has resources to produce the dna will not consume it themselves but rather follow the instructions to give feedback, or at the very least use it for their own research/education.
@@mikelezhnin8601 He said it at 10:45. CC BY-SA means you also have to release your derived work under the same license. The copyleft logo is even in the license's logo
It's unfortunate, because no pharmaceutical company with the resources to conduct trials will ever go for something tainted by copyleft. Should have gone public domain.
Couldn't click fast enough, that is an update a lot of people have been excited for. Allergies should not be part of life, they diseases. The quicker we cure them, the quicker a lot of people will have much better quality of life. Your project really gave me hope that in the future, modding a DNA "glitch" or adding a "feature" to one's DNA will be as easy as codding Java/C++.
and hopefully debugging will be just as easy or easier. writing code that causes a kernel panic is one thing, stuff you put in your own body is another
@@AugustusBohn0 our DNA is randomly shuffled every time we reproduce, and random cells get random mutations all the time. I think the fear that a "bug" in the genetic code would lead to cancer or other problems is overstated, people all too gleefully ignore the risks of non designer babies and of leaving their unsequenced mess of a DNA accumulate junk and ever more drastic glitches, it's hard to imagine we could make it much worse, the trade off is absolutely worth it when the status quo is our current uncontrolled disaster.
This stuff is huge. If you could cure diabetes even if the effect is not permament, they could live without injecting insulin. This would change their life and also a middle finger to those companies who are exploiting those people in the US.
That would be difficult. The issue with insulin dependent diabetes is that the pancreas stops functioning or functions too poorly to avoid the insulin. Non-insulin dependent diabetes is often reversible if you burn through the fat that's blocking the absorption.
As a future biology student this channel is so inspiring and uplifting as it shows how many things are yet to be discovered and it gives me something to look for when I finish my studies and start working on projects. Thank you so very much!
Three things: 1. I love your voice so much, like, it's so calming 2. I can't believe the Lactose Intolerance Genetic Therapy was a whole 2 years ago! WOW! 3. I love your videos so much! I love that you're helping spread interest in STEM and teaching people about science!
Every new video makes me glad I subscribed. I wish I had more time. You may not be able to save the world by yourself, but you're sure helping! Keep it up!
I need this and so do millions of people. It’s worth trying this out and getting clinicals going. I volunteer for any clinical trials as I’m tired of shoving lactate pills everyday or suffering if I don’t have it. I would love to eat dairy without a care again
I love the fact that you can use sequences from other organisms and have it work in a person's body! It's like jailbreaking your body. But this leaves me with one question: is it possible to use the treatment again or is the body resistant to the carrier now that it's done?
This is wild, I myself barely understand any of it, but the it's amazing you are able to do something like this, and even better that you are doing it under creative commons.
You might have just given me the most massive dose of motivation I have ever gotten for continuing with my Biochemistry degree. I hear this stuff does come under my degree and I hope my sources are right.
So, I'm really interested in this from a different perspective than just wanting to eat dairy again (which is like 90% of my struggle) I have Crohn's Disease. Some dairy I'm not sensitive to, say if it's baked into a cake or in a pill. If it's a chip flavorant, chez-it, or jusr cheese I'm screwed depending on how much I eat. More troublesome at restaurants when you don't know how things are prepared. Because one misstep isn't just a Lactose Intolerance reaction, its a risk for a Crohn's flare. So much fun. Currently on a course of Prednisone for forgetting a sandwich had mayo on it and eating it anyway. Mayo doesn't have dairy, but the same rule happens: I make a mistake because Im human -> I get real sick. Disproportionately so to the average lactose intolerant person. But mainly I just want to squirt a can of whipped cream into my mouth. I dream the smell of the food I miss.
I came here just for the lactose intolerant experiment and have never watched a video of yours before. I’ve never been more excited to watch something I barely understand. You’re fantastic.
Back when I saw your video where you took ther virus, I remember thinking "Permanent? Good luck with that." Although AAV has some of the longest durations of expression reported, for in vivo gene transfer, issues of transient expression are second only to inadequate number of transduced cells as a major problem limiting effects from the gene being transferred. And as you note, you are transfecting cells in the mucosa with a very high turnover. I haven't done any in vivo gene transfer work in years, so chitosan is new to me but it sounds better than the lipofection reagents I tried and failed to use for virus free gene transfer in vivo (I used HSV1 amplicons for to deliver serotonin receptors or cre recombinase along with GFP or DsRed as a marker to neurons). From what I read about chitosan you shouldn't have any issues with immune reactions limiting the ability to repeat the gene transfer. Viruses tend to cause immunologic reactions that reduce the effectiveness of additional treatments. The chitosan-DNA complexes shouldn't have that problem. So as long as you get good enough expression, even if expression is shorter lived, it should be easy to just re-treat. That is until the FDA decides to crush you, at least in the states. They really don't like this kind of work, and have already promised to throw every book they can find at anyone selling DIY gene therapies. It doesn't matter how safe the treatment should be or if people are making informed decisions about risk. Health Canada probably has a similar view though i don't know if they are as rabid about it.
I think better safe than sorry. As well, mass production introduces many problems. It is better instead to find a new regulatory method and let the scientists do the long work of establishing what works and does not work first before Pfizer gets it.
I'd be soooo thrilled to finally be released of the cramps of lactose intolerance. Mine is so bad and sensitive that sometimes I get cramps by drinking lactose free milk(≈0.1%). I am not knowledgeable to know if it actually is from the lactose and nothing else, but I'd still be happy to get rid of it.
This has got to be one of the most interesting videos I've ever watched. This is the first one of your videos I've seen and honestly its amazing. This is amazing content, keep it up. If you don't mind me i'm going to go read some of those studies on genes you were talking about.
I've been lactose intolerant since my 40's. I'm also allergic to Penicillin as you mentioned about yourself. In your research, have you discovered any correlation with lactose intolerance, and allergies to an antibiotic such as Penicillin? I also suffered from Ulcerative Colitis with the result of losing my Colon in my late 20's. All three are probably inherited traits. Recently in my 60's, I discovered that I have a mutation called Factor 5 Leiden type one that allows my body to produce extra clotting factor in my blood. So now I take a blood thinner. (4 bad genes? pretty lucky guy---LOL !)
I hope something like this can be become available to the public soon. I’m extremely lactose and fructose intolerant and it is such a hinderance on my life. I’m wondering if this sort of research can be used to cure not only lactose intolerance but other food intolerances such as mine.
I have celiac disease, so this work is SUPER FREAKING EXCITING for me. I know what my immune system does is a lot more complicated than just prompting your body to start producing an enzyme that you used to make, but I hope that someday, it can be done. Even if I have to reup regularly, I'll freaking do it. I miss proper bread...
It's much easier to modify wheat to simply not cause allergy. There's a couple of groups working to make celiac free wheat. There's 2-3 small sections of the gluten proteins that can be removed without otherwise affecting the function of the protein, but makes it hypoallergenic.
Well done! That's incredibly useful. Thank you for your informative videos and scientific research. I hope to be able to do the same someday, and you are a fantastic inspiration!
So, two things. 1) Awesome project. You put out such great quality conetent. 2) This will NEVER make it to people as a creative commons project. This is an unfortunately common misconception in the biomedical and pharmaceutical industry, and society at large. That giving away the secret sauce to a drug or therapy or solution or device will let everybody benefit from it. The opposite is true. Because of our modern-day regulatory system, the biggest cost of any drug or therapy is the testing and clinical trial stage. This can costs millions or even tens or hundreds of millions of dollars depending, and maybe a tenth of new therapies make it through this stage to market. So figure anywhere from $50 million to $1 Billion to get a functional drug developed, certified and legal to sell. And once you get it certified as safe - that's it. It's proven safe. So anyone can duplicate what you did, and they get to skip all those nasty clinical trials and all that expense. Testing a new drug or therapy or device constitutes a MASSIVE, UPFRONT, UNRECOVERABLE cost. So no one will EVER put that money forward to get it done, since they'll never get any of it back. Everyone will line up to be second, but no one will ever be first. That's why patents exist - so that people can exclusively sell something for a limited time as a monopoly so they have a chance at recovering all their development costs. No Patent = no recovery of costs = no one willing to pay those costs = no drug ever being developed, tested, and delivered to market. Sorry, but that's just the truth of the matter. Any and all open-source medical therapies will never, ever get to be used by the general public. The best way to ensure the public has equal access is for someone private to maintain the rights, get a patent, go through the clinical trials, charge a seemingly absurd amount per unit so they can recover their costs (and thus satisfy the investors that agreed to foo the bill for the trials) and then let the public get limited access during the patent period, followed by widespread access once the patent expires and generic manufacturers drop prices down to consumer-grade levels. The only way this particular design of yours will ever reach people is if they explicitly disregard what you say and self-administer this therapy.
@@jeffvader811 most people don't, which is why it has to be made explicit. University programs are often deliberate in making this point. Going through some biomedical courses in college, all of the guest professors had stories about one project or another that they worked on, which was an effective therapy, which nobody ever got to use because they couldn't secure a patent for it, due to prior work or other considerations. No patent = no help to the public was something drilled into us.
This is why I think governments should make there own drug companies in order to help develop drugs like this that are good for society but not market viable.
Yes systematically speaking this is correct. But the market is the market, if someone DIY's a real solution, there will be people monetizing it minus the upfront costs. After all, if we assume no problem with the technology and it is eventually accepted in limited fashion, there will be many many buyers and at that point, its supply versus demand. It will be expensive then before it gets cheap as with everything else.
Really good and informative video!;) Regarding your opening: As a long time vegan, at this point naturally going lactose intolerant (like pretty much every adult mammal), I can very much relate to your anger about lactose in random food it has no place to be in. Not only is it the most common reason stuff isn't vegan but it's also extremely annoying, should I accidentally miss it on the label. Do you try to eat vegan/ lactose free or don't care at all anymore and just rely on pills at this point?
A beneficial side effect of this is that you're now GMO and are thus safe from upper-middle-class cannibals.
Charles Lambert Loool
Everyone who gets the UK COVID-19 vaccine will be a GMO too, if they ever prove that it is safe and effective in humans.
@@DanielSMatthews rna does not count, why? cuz I said so
They might be fooled if you just label him free range.
Charles Lambert I laughed way too hard at that, thank you.
“I hope this doesn’t kill me” ah yes, the best kind of science.
Google Dr. Barry Marshall, he was so confident in his hypothesis that a bacteria he had cultured caused stomach ulcers directly that he drank some, developed ulcers, then successfully cured them with antibiotics.
In that case he had discovered the bacteria in otherwise healthy ulcer patients. So he knew going into it that his worst case scenario was being right and getting temporary stomach ulcers, whereas in this case he had a non-negligable risk of cancer and/or painful death
If you’re at ALL concerned about health, get rid of the cats (toxoplasmosis), toxo is real , and REAL BAD: mild to severe depression, headaches, flu symptoms, nerve twitches, schizophrenia, Parkinson’s, cysts (often misdiagnosed), low vision, eye floaters, detached retina, miscarriage , congenital in cats and humans, 1bil micro eggs hatch from a litter box in a week, eggs can live 2yrs in bleach water and still hatch(Usa navy Oahu research) , cats constantly re-infect themselves , negative tests are inconclusive due to a long dormancy potential, a dormant cyst can outlive the antibodies being tested for, as it waits for a weakened immune system, some people have an immune system that will beat it, no antibodies can also mean it has advanced without a fight, natural and medical treatments exist . Goal of toxo is to re-wire the brain , the litter box doesn’t smell and the cat is the most important thing . In 2 separate studies 85%of motorcycle fatalities test positive for toxo. Many behavior changes. (Dr Flegr) Pregnant women shouldn’t go near a litter-box , cat house , or cat dumpster , actually nobody should. Domestic cats are not native in the USA. Don’t eat undercooked meat or fish . Most vets don’t know enough to advise people.
😂
Bro science
Code an enzyme which can break up cellulose so you can eat wood
lol a whole new meaning to tree hugger?
I think the real issue is chewing.
You could eat that backstock of toilet paper
Might be easier to figure out how termites get the bacteria they have in their gut that do this for them to stay alive in their gut, then apply that to humans.
@@AkaiAzul why not just steal the gene from the bacteria and produce is yourself?
DUDE!!! You just blew my MIND!! I’m not lactose intolerant, but I am so excited right now at the implications of this! You are a fricken hero!
just chill man
@@upupina90 I DON’T KNOW HOW!! PLEASE HELP!!!!
@@BlackGryph0n It's been two years, and you are still so exited...
I'M IN THE SAME BOAT!
Doesn't seam that exiting but eh. It is probably going to get actual research some time
@@BlackGryph0npretty cringe
18 months of lactose tolerance sounds incredible compared to having to take so much lactase. That is so impressive I would love to see it come commercial
"I'm a programmer"
"Oh, what language?"
"DNA"
Language - God
as a programmer i'm hella excited about dna and the implications of manipulating it for the better. like, mind me being an agnostic boi, if god exists he's definitely a coder. i love this shit
@@tedarcher9120 CreatorIDE
agcgaaaacgataacgtggatgaaagc
Interviewer: So here you wrote that you do coding. In what language?
Me: Oh, ya know, deoxyribonucleic acid.
18 months of lactose tolerance, and a lingering improvement once it wore off is pretty amazing though. Certainly a great proof of concept.
Just taking more seems to be the solution
@@redreaper2088unfortunately its a virus so your body would develop antibodies and reject the treatment eventually.
With the human-compatibility improvements he made on top, I wonder how much more effective it is now
EDIT: Wow, he does mention it might last years in the video...
@@redreaper2088 Not really, the immune system learns that original virus so a new one has to be used, and there are only so many adeno viruses
@@BeefMeisterSupreme fair
"Heroic levels of lactose" best line ever
Guess he got that term somewhere ;)
Legend
Dairy
@@grinreaperoftrolls7528 This.
Dairy products*
Remember to take it in silence in the dark
Thanks for the bugfix! Shame the devs didn’t patch out this one, but we can always rely on the community to do it!
Many patched copies of humanity exist, which is why the buggy copies are considered sick.
@@johndododoe1411 Yeah, people ought to stop using outdated copies and then complaining about bugs 🙄
@@book-obsessedweirdo8677I mean not everyone can get updated models to be fair
@@voguishthrone5887 Fair point, fair point.
@@book-obsessedweirdo8677 easily the most logical discussion yet
where can I download the update?
born too late to explore the world. born too early to explore the universe. born just in time to explore ways to *e n h a n c e* humans
To be fair, explorers of the world (and will probably be true for the universe exploring) often had early gruesome deaths.
Even if it wore off the fact that it lasted that long is super great so I commend you for your efforts
Exactly, I don't see why this can't be considered good enough. Just like we can get a seasonal flu vaccine, we could do the same thing with AAV treatment. They are very easily mass produced anyway.
@@justindie7543 One of the many downsides to an AAV is there's a high chance you produce antibodies against them. So it's a one off and can't be reused most of the time.
@@thethoughtemporium For unrelated reasons I recently learned that immunity to some viruses tends to wear off over about the same timescale. Is this so for AAVs?
@@thethoughtemporium I don't even want this for consuming lots of lactose. Just to stop the advancement of my condition.
How did you synthesize this, did you hire a company, or culture it yourself?
@@thethoughtemporium will you try reusing it on yourself to try if you can get it to extend the wear off time? - a try wouldn't hurt i guess? (for the recort: i am just a interested nerd and no expert...)
normal person: oh, I'm lactose intolerant I guess
thought emporium: oh, I guess I'll get a degree in genetics, make my own lab and fix my lactose intolerance
well he *became* lactose intolerant, which is kinda different from being lactose intolerant ever since you were 1 year old
@@phillipanselmo8540*TL;DR: becoming lactose intolerant as you age is perfectly normal and shouldn't be seen as a medical condition. It's rather lactose **_tolerant_** adults who should be viewed as weird.*
Infantile lactose intolerance is extremely rare. Before the invention of baby formula, that condition would mean certain death to any newborn in short order.
In most mammals (as in each one except humans), the production of lactase ceases as they are weaned off of their mother's milk. Humans with lactose intolerance don't have a defect by any means. It just simply means they lack the mutation that allows humans to produce lactase past infancy.
Lactose intolerance is rare in Europe and the middle east, as these cultures historically relied on animal milk for survival, but go to China and it's the other way around. Lactose intolerance is the rule, not the exception the gene still exists, perhaps due to crossbreeding with European populations, or perhaps their ancient ancestors had the gene before they arrived in Asia, and later lost it due to the lack of a selective pressure to keep it. Producing the enzyme isn't free of course, so losing the gene frees up energy and resources for other tasks.
I wonder if this guy will be able to edit DNA to cure hair loss.
that is honestly the nerdiest thing I've ever seen, "I'm just going to make my own medicine, here we go"
Screeches in BIg Pharma.
This is far more than that. Making your own medicine can be as simple as learning about a few plants and mashing them in a bowl. This guy "home-brewed" a custom virus in order to target and alter his own DnA. It's pretty crazy that such a thing can be done these days.
@@UnknownSquid Yeah, not going to the doctor and making your own medicine is standard fare for a good percentage of Americans.
As far as I'm concerned, you aren't a real American unless you've bandaged up a wound that desperately needs stitches, or at least considered buying antibiotics on the dark web.
@@derp195 I still have a big round scar on the inside of my elbow where a gaping hole once was. Probably should have had a couple stitches. Instead got some sterile gauze and a compression wrap. (Thanks mom)
Though going back to the scene of the accident and looking at the dried pool of blood that ended its cardiac journey on a patch of asphalt baked in the hot summer sun had a somewhat profound effect on me. At least until it rained. My that was a long sentence.
@@UnknownSquid If you listened closely, he specifically noted that this gives his cells a plasmid. It does not alter his own DNA. 8:50
This right here is the pro of not being depending on a university. You are your own ethic department.
Justin: "Am I allowed to do this?"
Justin: "Yes, yes I am."
And a popular youtuber doesnt have to beg for grant money for a project. Advertisers will chuck cash at him to do it
"Am I really going to re-write the DNA structure of my GI tract so I can drink milk?"
"Of course I am!"
I can't like, you're at 444!
If I had the financial means I would experiment with all kinds of things, even the most tabu... So I think it's safe to assume that all kinds of things happen in the shadows.
Well, experiments on one's self are a proud tradition in medical and scientific community. I don't know ethics boards' guidelines but i wouldn't be surprised if a project like this would be given a pass.
I'm a Biologist who randomly came across your channel today, and I must say..If this is not revolutionary science, I don't know what is! The fact that you went with this whole project is simply mind blowing. I hope that you've collected a shit ton of data, and are willing to back up your claims and help spread the word that Biology, if practiced carefully and with full awareness, can virtually achieve the impossible!!
the fact that he doesnt show us any data at all concerns me the most...
USA went from a space race and telecommunications revolution to electing a Tangerine for president only to follow up by electing a Narcoleptic president. If we invested money into truly innovative individuals like this we would be so much better off.
@@exodeus7959 Don't worry, that'll never happen, the US population stock is only getting worse by the day, not gonna be having many Edisons and Feynmans anymore lol
What I don’t understand is if this guy can give himself a year of tolerance, how is a pharmaceutical company not making couple thousand per person per a year making a commercial product? Are clinical trials just that expensive?
I feel like there must be more to this that I’m not understanding
@@frankda4probably the safety component and there being a much more lucrative market for treatments that already exist.
As medicine student this makes me feel excited, this is the content that really deserves support.
Haven't taken that research ethics class yet have you
Of course I have, Humanistics btw. It is essential to do research and especially in cases where human lives are in danger, the video even said that these studies are far away from even being optimal to test in humans, I wasn’t referring to the part of him using himself as subject of course, but the part where he explains the process and new advancements in research.
The sad part is we'd likely be much further alone in gene research if it wasn't for the fact that around 20 years ago when genetics was just fully ramping up it was utterly shut down because of bible thumpers crying out because it's playing god, SO here in the US, the only research being done is by the private sectors so long as they have ZERO government money going to them for research....
So essentially no major collages or any other US based medical company can touch genetic research..
@@SilvaDreams that’s not right, there’s lots of genetic work being done in universities, it’s the human testing that is hard to get approved.
The fact that a medicine student believes this bullshit is worrying.
As someone who worked in a lab at Johnson & Johnson -- You are amazing. I wish this form of open crowdsourced pharma research was more common.
I know most people see "big pharma" as evil. I think it's a double edged sword, there will always be a need for proprietary R&D backed by deep pockets. But the closed source software dominance has been balanced out by open source. There are still a lot of closed products, but the open source community is thriving as never before. I have a feeling this revolution could just as well happen for pharma R&D.
One can only hope
Yeah. Soon companies would realize the free R&D that comes with open sourced stuff.
I think we should also give tax funded universitys doing public research deeper pockets.
I've been following some open source labs, and it's very exciting--is The Pipette Jockey on your radar?
Actually there such a thing. A local hacker space that I'm a part of does just this . If you look into I'm sure you'll find exactly what you are wanting.
Bayer CEO: *starts sweating profusely as he sees a chance for profit wasted by creative commons*
Joke aside, outstanding work! Glad to hear there's still pizza in your life.
You can still make a profit from creative commons content. :)
You can still make a profit from creative commons content. :)
@@RubenKelevra In principle, yes, but nobody is going to go through the process of getting this sort of treatment FDA approved without a government enforced monopoly to let them charge exorbitant amounts of money that render it exclusive to the outrageously rich.
@@Plotatothewondercat You can't really win either way. Look at how many people died with stomach ulsters, believing it was stress when it was actually bacteria, and that was due to it not being profitable to test due to not being able to make a large profit selling penicillin. A guy down here cured his wife of MS with penicillin - it cleared a bacteria blocking blood flow in her brain -, but no one will test it as there is no money in it. Big Pharma - also the record industry, lol - are all about exploitation. They say it costs a trillion to develop a drug, yet the pay students with an idea $9000/year for 3 years to see if they can make their idea work. I bet all that investment is also tax deductible.
I bet these substances will be banned soon like THC
Some thoughts as a previous synthetic bio researcher:
A downside of AAV therapy is that the human immune system learns to recognize the specific virus, meaning that a person won't likely be able to receive gene therapy using the same viral carrier more than once. Though there are a number of adeno viruses species we can use, it isn't unlimited. A lack of thorough documentation of who's been infected with what further complicates the issue. There's also the possibility of an overreactive immune response as well.
Working in silico on Benchling is a fun and interesting way to learn about DNA and gene functions, but wetlab experience will show that synthesizing such a plasmid will be difficult as described. Like the CRISPR plasmids more commonly made these days, their large size makes them difficult for bacteria to replicate and opens room for unforeseen genetic regulatory error and problems--not all that are well documented.
Scientific literacy is always worthwhile to pursue, but some members of the public can learn to curb their enthusiasm as they discover the nuts and bolts of the actual process.
thank you, finally someone :)
can you even transfect this huge plasmid effeciently?
I just want to mention how amazing the term "in silico" is. I'll need to keep that in mind whenever I refer to computer simulations
@@SB-nh7uv probably yeah
As someone with no knowledge of biology beyond what little I remember from high school, the idea that popping a pill is something that can literally change your DNA is hard to wrap my head around, kudos to you for actually being able to do that
I wonder if it can work for physical conditions. Could it cure bilateral club foot? I mean my feet had to be completely reconstructed from the ground up. Bilateral club foot is actually quite easy to treat at a young age, just that I think my doctor messed something up or I didn’t wear the feet aligners enough and I ended up with messed up feet for my entire life. Or maybe this could be a real cure to autism. Then again curing autism sounds like something that would kill you metaphysically. Like you’d still be there but your personality and what makes you you would be so irreversibly changed you’re basically dead. Asthma could however be something this could easily treat.
@therealspeedwagon1451 autism isn't really something to cure, personally (as an autist) I massively dislike the idea of autism being a disease. most of us are just a bit different, and the incredibly low functioning autists will 99% of the time have other more severe issues that directly contribute to their disability more than autism
@@friendlysnoworb6091 Yes, there are aspects of it that could potentially benefit from a cure, but keep in mind that humans have extremely poor judgment when it comes to things like that. I'd love to know when I'm thirsty before I'm significantly dehydrated, but curing it would change me into somebody else entirely and much of the issues either have workarounds or are the result of society just not being set up for us.
@@friendlysnoworb6091I mean personally if I could press a button to make it go away I wouldn’t even need to think about the decision. Yeah, maybe the unpleasantness of having it is a result of society not adapting to it. Who cares though? I don’t see it changing, neurotypical people have a kind of instinctual revulsion against those who are different. I don’t care why it’s unpleasant, I just know it is.
I'd rather not have autism but the idea that it's remotely curable after you turn like two years old is ridiculous. Most of the effects that suck can be modulated with, for example, oxytocin, tho there isn't really research into administering it for tamping down the worse parts of having a developmental disorder
Him: "I hope that doesn't kill me... :D"
Her: "that's NOT funny!!!!"
im new to the chanel is she still around?
@@therealmacgyver5470 I don't know
@@danukerudesu8919 LOL!
A reaction video of you consuming "Heroic Levels of Lactose" would have been a viral hit.
Watch the old video. He did.
hehe
viral hit
Instead of this: virus
Say this: organic patch engine
coronaorganic patch engine
Turn off your immune system while the patch is being loaded.
*58% completed*
@Joe Alexander sounds like a too complecated procedure for a small benefit,also further down the line if some other thing takes advantage of this loop hole you put in the body will put the person at risk won't it?
2021 here we come
／|＿＿＿＿＿＿＿＿＿＿
〈 To BE CONTINUED… |
＼|￣￣￣￣￣￣￣￣￣￣
OPE for short
“Chitosin can cost pennies”
Pharmaceutical companies: hold my beer
Really do be marking up insulin's price by 50x though.
@@tsumikiminiwa4603 Only in America.
@@1d10tcannotmakeusername actually it's marked up more outside u.s, because companies love scamming the government lol.
@@gabrielc7861 Europe: are you sure about this
@@gabrielc7861 lol. That's just not true. Insulin is 10x cheaper in Canada and almost everywhere else in the world
This is amazing. You’re showing me that my childhood dream of having my own little “dexter’s lab” at home is possible. I’d actually love it if you made videos instructing how to set up and run your own lab for different experiments along with the costs, licenses and training needed for any of the equipment.
If you need a video to tell you how to do it you don't know enough to do it safely.
@@alextell7019 Oh, of course. I'm assuming that I'd need real-world, hands-on training. The video would instruct on what kind of training I'd need among other things. Makes sense, right?
@@iDigsGiantRobotsunless you want to go to university for 3+ years and have decent money, you can’t do this
1st I love this channel!
You motivated me to pursue microbiology and genetic engineering.
Thank you for doing what you do! Keep up the great work!
I just recently developed lactose intolerance after an illness, so being able to go back to lactose-filled foods would be great! Very excited.
@ivan schafeldt How is this relevant?
same boat as you, I also obtained an egg alergy at the same time because I ate almost nothing but eggs when I had the intestinal infection. warning to everybody stay away from eggs when you have an strong immune response in your digestive system because your body has a decent chance of getting mad at the proteins in eggs forever.
having to take lactase tablets is inconvenient but no eggs ever is the worst thing eggs are pretty much in everything good.
Was it from antibiotic treatment? If so, you could likely restore most of your digestive function with probiotic treatments.
@@sebimoe it's irrelevant because science reasons
Our DNA is now opensource. Damn I love the future.
Human DNA is known and public for a while now
Since the 1980's
@@Slekejkwls-1819 2003. The human genome project ended in 2003 after more than a decade of groundbreaking work. I think it's even more amazing to say that a task which 20 years ago took us 13 years, billions of dollars, and the greatest minds the field of genetics had to offer to can now be accomplished by any random bloke equiped with the internet and a cup of coffee at his kitchen table. Having a technology mature and progress so rapidly is remarkably rare. It can be compared to the rapid development of aircraft in the first half of the 20th century, and the exponential growth of both the quantity and quality of digital computers from the 70's until the late 2000's
As an aspiring biochemist this ranges from inspiring to amazing, well done.
Not gonna lie, 18 months is still absolutely an amazing timespan for this test.
putting this out CC is like, some transhumanist accelerando shit and I love it.
i like how u said that :D
man it makes me really worried. This guy did everything safe, and smart. But no guarantee for that with other/new methods.
Hopefully people will stop asking for an update on the livestreams now
"We don't know exactly how it works, just that it works."
Aah yes. Biology
It warms my heart to see that this kind of science is still out there. You, sir, are the kind of person that motivates the hell out of me. I had rejected a PhD offer because I was kind of disillusioned by the current state of accademia but you've inspired me to reconsider it.
Shoot can't wait to see full-blown game changing mods to DNA just think of the possibilities. Hopefully the current hard code can become editable soon
That is all fine and dandy and can probably help people with a lot of issues, but I feel like that can very easily lead to human chimeras that can very well lead to a far more difficult life, simply because playing with your genome is so unpredictable.
@@vodkastudios4170 As long as you can undo any problematic changes, that wouldn't really be a problem.
Your channel is so hilariously underrated.
I'm sorry, but I rlly have to do it..
Your*
*Youar're
*ooga booga
@@Hexthrill ty :>
@@OleZZ222 you're very welcome my good sir
"Please don't test this on yourself"
Me: There has been tremendous pressure to regulate this plasmid business. There have been side effects: blindness, insanity, death. But what use is our ideology if it is not tested?
J.Azz. Woods bioshock
Brofist!
The market does not respond like an infant, shrieking at the first sign of displeasure. The market is patient, and we must be too.
"Curiosity killed the cat but satisfaction brought it back."
So perhaps, that risk is worth taking.
Wow this is really interesting. I have a doctorate in an area of health science and my B.S. is in Biology. I'd would NEVER have the "guts" to mess with this type of experimentation. I'm completely impressed and totally horrified by this lol
1) Man your such a good guy. So freakin cool
2) When something like this eventually reaches mass production they will have to be vary careful to remove/neutralize/break down the penicillin. We don't want any super-resistant bacteria to form after all.
this is amazing! i just discovered your channel and i'm so eager to watch more about genetics. i'm a huge bio nerd, mainly because i have a rare metabolic syndrome and i like learning how it all works. awesome stuff!
"Please, please, PLEASE don't text it on yourself"
Ok, I got it.
Now, where's my sister?
You: "here, take these pills"
Her: "What are you doing stepbro?"
@@shipwreck9146 >step
I wanted to repeat your experiment, but with alpha galactosidase, to cure my ibs, but then I started making my own kefir, and that totally cured my ibs. All it was just a gut disbyosis.
Engineered probiotics and a well managed microbiome is the future of preventative medicine.
@@DanielSMatthews why can't we engineer a probiotic that can make enough lactase for our needs then we have all the benefits of gene theropy without changing your own stuff
Can you tell us more about this kefir? I might have ibs and it sucks.
@@ChrisD4335 that is a very good question...
@@ChrisD4335 We are full of microbes that produce lactase. That's exactly what lactose intolerance is: gut bacteria digesting the lactose we couldn't digest ourselves.
Apply it to gluten intolerance & autoimmune reactions in Celiac's
Was just thinking that. I want to be able to eat bread and grain again. Even gluten free is no go.
"Im lactose intolerant and allergic to penicillin"
*tries to fix lactose intolerance*
He's got his priorities right.
Cheese > Life
Last time i looked pizza dont have penicillin
Well... Lactose intolerance could be considered low hanging fruit.
@@bjam89 it will if you forget about it
This is utterly bizarre and mind-blowing! I LOVE the DIY esthetic but never would’ve imagined it could translate to gene editing! This sort of work is so very important because it created a proof of concept so quickly! It would take a big company decades to do this! Bravo! Keep on truckin with yo industry disruption!
Could you do the same thing so your DNA codes for Vitamin “C” manufacturing in the body
likely It's really only primates that can't make vitamin c
Well, theoretically, you should be able to do the same with any enzyme (just assuming you have DNA that encodes something that will produce Vitamin C), but I think doing it with Vitamin C would be more dangerous. With this, the worst that can happen is you have too much lactase in your stomach, which shouldn't really do anything other than digest lactose (I am assuming the only possible failure is over-functioning). If you add something that makes Vitamin C to your body, especially if you let it replicate like this new version is meant to, you could run into problems. If it replicates too much or ends up making you produce too much Vitamin C, you will have too much Vitamin C in your body, which can lead to some serious health problems and eventually cause major damage to organs (more likely if you are consuming too much iron or have other health problems).
As far as I know, it would be extremely difficult to remove this DNA sample from wherever you spread it, so unless you have something ready that you know can remove around the same amount of Vitamin C, it could be potentially disastrous.
Technically yes, BUT it's way harder. We're only missing one enzyme in the vit C pathway, but the reaction it does to make the final vit C is kinda narly, so it has to be done in the liver to deal with the free radicals it outputs in the process. But modding a liver is ridiculously hard. The cells just refuse to keep the mod so they almost always fade in less than 6 months and getting the DNA in there in the first place is hard.
@@gorrium5027 - I think that is the point of the question. Rather unfair that we're the only ones who can't produce our own vitC. :(
@@gorrium5027 there are a few others too, I think most bats can't and I know guinea pigs also cannot
Thank you so much for doing this video! I was one of the people that asked about it a few times. Absolutely incredible experiment and I really appreciate the follow-up!
I don't see why the AAV treatment isn't good enough? Having to take a few pills every year instead of every meal is a hell of an improvement.
Here's a very simple experiment, try taking the AAV treatment again. Does it still last the same amount of time or will the immune system resist it?
apparently you're very likely to become immune to the virus, so it only works once.
I think in short is that AVV Treatment is a bit expensive and the treatment with chitosan seem to be cheaper and easier
^ plus I thought he said that it has a chance of cancer.
@@tobiasfellmann7692 only if the cells integrate the DNA, what I don't think is the case.
Tobias Fellmann The chance of cancer was mentioned in regards to the new version being more human adapted and designed to hide from the immune system, however he mentioned that it is specifically designed to not integrate into a person's DNA to reduce that chance. Likely the danger does not exist, but as stated, it requires more testing. Do not try on yourself.
As someone who lost lactase production recently, in their early 30s, I am extremely excited about this research and the potential it represents. Here's hoping a commercially-viable solution is available in our lifetimes. I really appreciate the work you've done to move this forward within the community.
My grandmother has been lactose intolerant since birth. Shes never had a real glass of milk. I feel like this would be a great gift for her.
THANK YOU! I've been waiting so long for closure on this project.
I love the idea of open source DNA. That's so cool how much it translates to software. I love the idea of seeing the equivalent of someone finding a "bug" in the code and it being committed to the master
Oh shit! Chitosan sounds like just the thing I need. There's a way to reliably differentiate most cancer cells with no false positives by looking at MR1. I was trying to integrate it into existing T-cells, but now that you mention it, a standalone single use sequence with no integration or replication would be way easier and safer
This is a very cool project. One comment- mammalian cells actually do have many ori sequences- the c-Myc ori has been cloned into plasmids which replicate as episomes in mammalian cells. The SV40 ori works for this too and is the most commonly used.
This video is so cool. I just wanted to clarify something mentioned at the beginning however: *milk is not a waste product.* Research conducted at the Edinburgh University which got information from the Global Academy of Agriculture and Food Security released a study in 2018 that showed that 50% of loss of milk product is from retailers, distributors, and consumers, while the other 47.4% of it is from spoilage and waste at the farm or while the milk is being distributed and exported. Dairy cows are actually an entirely different breed from beef cows, so it's not like milk is a byproduct of anything. Factory farms actively increase or decrease their yield to meet market demand. Overages occur as a result of balancing an equation of production cost and potential revenue from unpredictable shifts in market demand which via markup justifies some loss. It's just a natural result of our on-demand food market systems. So milk really isn't a waste product anymore than any food item is. Thanks again for the video. Gene therapy stuff is so cool.
1. People ARE going to test this on themselves - 99% sure.
2. Now I wonder: does health insurance cover cancer induced by modding your own genome?
problem is with the cost of the materials and the knowledge needed. its not too likely.
@@brendethedev2858 yeah those who can know not to test in on themself
well they are probably gonna say yes that they cover cancer but when you actually get cancer from gene therapy because of an error then they simply won't pay as always.
@@sontapaa11jokulainen94 how would they know that it was self induced. Like sure if you post online about it, but most people would do so anonymously. AKA don't snitch on yourself.
@@cg4tw855 anything that modifies DNA is typically given a marker to show that it was from a genetically modified source. I assume(since i have not looked at the github section for this yet) that this particular DNA code has that marker in it, and to produce it will need to contain that marker. however if you know what you are doing you could technically remove it but most anyone who knows these processes and has resources to produce the dna will not consume it themselves but rather follow the instructions to give feedback, or at the very least use it for their own research/education.
Ah yes Copyleft DNA, very cool :D
as god (richard stallman) intended
Yeaah, that's not how creative commons license works though... It's not copyleft, it's do whatever you want.
@@mikelezhnin8601 He said it at 10:45. CC BY-SA means you also have to release your derived work under the same license. The copyleft logo is even in the license's logo
@@hermannpaschulke1583 Yeap, you are right. I missed the SA part.
It's unfortunate, because no pharmaceutical company with the resources to conduct trials will ever go for something tainted by copyleft. Should have gone public domain.
Couldn't click fast enough, that is an update a lot of people have been excited for.
Allergies should not be part of life, they diseases. The quicker we cure them, the quicker a lot of people will have much better quality of life.
Your project really gave me hope that in the future, modding a DNA "glitch" or adding a "feature" to one's DNA will be as easy as codding Java/C++.
and hopefully debugging will be just as easy or easier. writing code that causes a kernel panic is one thing, stuff you put in your own body is another
@@AugustusBohn0 our DNA is randomly shuffled every time we reproduce, and random cells get random mutations all the time. I think the fear that a "bug" in the genetic code would lead to cancer or other problems is overstated, people all too gleefully ignore the risks of non designer babies and of leaving their unsequenced mess of a DNA accumulate junk and ever more drastic glitches, it's hard to imagine we could make it much worse, the trade off is absolutely worth it when the status quo is our current uncontrolled disaster.
This stuff is huge. If you could cure diabetes even if the effect is not permament, they could live without injecting insulin. This would change their life and also a middle finger to those companies who are exploiting those people in the US.
That would be difficult. The issue with insulin dependent diabetes is that the pancreas stops functioning or functions too poorly to avoid the insulin. Non-insulin dependent diabetes is often reversible if you burn through the fat that's blocking the absorption.
There are a lot of non-injection alternatives besides that. Afrezza was an inhalable version of insulin.
As a future biology student this channel is so inspiring and uplifting as it shows how many things are yet to be discovered and it gives me something to look for when I finish my studies and start working on projects. Thank you so very much!
Damn, I hadn't even heard about the original project! This is so cool!
"... but the important thing is that it works."
Three things:
1. I love your voice so much, like, it's so calming
2. I can't believe the Lactose Intolerance Genetic Therapy was a whole 2 years ago! WOW!
3. I love your videos so much! I love that you're helping spread interest in STEM and teaching people about science!
Every new video makes me glad I subscribed. I wish I had more time.
You may not be able to save the world by yourself, but you're sure helping! Keep it up!
Holy shit, this is the best thing TH-cam ever recommended me to.. why haven't I known about you earlier?!
When I grow up, I want to be like you
Wow TH-cam finally recommends something that I would actually want to see from someone I don't watch
Bio Hackers: **debugging the human genome**
...
We're living in the future aren't we?
I need this and so do millions of people. It’s worth trying this out and getting clinicals going. I volunteer for any clinical trials as I’m tired of shoving lactate pills everyday or suffering if I don’t have it. I would love to eat dairy without a care again
One of the coolest videos I've seen in a while.
Excuse me, you figure out how to make tomatoes spicy, can you like do that because that would be amazing
Take the spicy gene from something else and copy paste it into the tomato.
@@15Redstones nope. Turns out tomatoes have the capsaicin genome. It's just turned off, but you can turn it on.
You must be from India :)
Mix it with peppers? Same family?
I love the fact that you can use sequences from other organisms and have it work in a person's body! It's like jailbreaking your body. But this leaves me with one question: is it possible to use the treatment again or is the body resistant to the carrier now that it's done?
As mentioned in another comment, it's possible your body will produce antibodies against the virus and so it won't work the next time
This is wild, I myself barely understand any of it, but the it's amazing you are able to do something like this, and even better that you are doing it under creative commons.
This is honestly a miracle pill. Bravo sir, bravo.
You have no idea what I would do for this pill. I need this pill. I NEED THIS PILL!!!!
Creative Commons license... This man be a good human
You might have just given me the most massive dose of motivation I have ever gotten for continuing with my Biochemistry degree.
I hear this stuff does come under my degree and I hope my sources are right.
So, I'm really interested in this from a different perspective than just wanting to eat dairy again (which is like 90% of my struggle)
I have Crohn's Disease. Some dairy I'm not sensitive to, say if it's baked into a cake or in a pill. If it's a chip flavorant, chez-it, or jusr cheese I'm screwed depending on how much I eat.
More troublesome at restaurants when you don't know how things are prepared. Because one misstep isn't just a Lactose Intolerance reaction, its a risk for a Crohn's flare. So much fun. Currently on a course of Prednisone for forgetting a sandwich had mayo on it and eating it anyway. Mayo doesn't have dairy, but the same rule happens: I make a mistake because Im human -> I get real sick. Disproportionately so to the average lactose intolerant person.
But mainly I just want to squirt a can of whipped cream into my mouth. I dream the smell of the food I miss.
Some people are putting Crohn's into remission with ketogenic or carnivore diet, there are some videos on TH-cam about that if you want to take a look
I came here just for the lactose intolerant experiment and have never watched a video of yours before. I’ve never been more excited to watch something I barely understand. You’re fantastic.
This is quality gene therapy content. Absolutely fabulous.
Back when I saw your video where you took ther virus, I remember thinking "Permanent? Good luck with that." Although AAV has some of the longest durations of expression reported, for in vivo gene transfer, issues of transient expression are second only to inadequate number of transduced cells as a major problem limiting effects from the gene being transferred. And as you note, you are transfecting cells in the mucosa with a very high turnover.
I haven't done any in vivo gene transfer work in years, so chitosan is new to me but it sounds better than the lipofection reagents I tried and failed to use for virus free gene transfer in vivo (I used HSV1 amplicons for to deliver serotonin receptors or cre recombinase along with GFP or DsRed as a marker to neurons). From what I read about chitosan you shouldn't have any issues with immune reactions limiting the ability to repeat the gene transfer. Viruses tend to cause immunologic reactions that reduce the effectiveness of additional treatments. The chitosan-DNA complexes shouldn't have that problem. So as long as you get good enough expression, even if expression is shorter lived, it should be easy to just re-treat.
That is until the FDA decides to crush you, at least in the states. They really don't like this kind of work, and have already promised to throw every book they can find at anyone selling DIY gene therapies. It doesn't matter how safe the treatment should be or if people are making informed decisions about risk. Health Canada probably has a similar view though i don't know if they are as rabid about it.
I think better safe than sorry. As well, mass production introduces many problems. It is better instead to find a new regulatory method and let the scientists do the long work of establishing what works and does not work first before Pfizer gets it.
"I downloaded virus" gets whole new meaning now.
Thoughts on having endogenous gut flora produce the lactase enzyme instead of the intestinal lining?
I'd be soooo thrilled to finally be released of the cramps of lactose intolerance.
Mine is so bad and sensitive that sometimes I get cramps by drinking lactose free milk(≈0.1%).
I am not knowledgeable to know if it actually is from the lactose and nothing else, but I'd still be happy to get rid of it.
This has got to be one of the most interesting videos I've ever watched. This is the first one of your videos I've seen and honestly its amazing. This is amazing content, keep it up.
If you don't mind me i'm going to go read some of those studies on genes you were talking about.
It's so amazing what you were able to do!
"Hope this doesn't kill me. More to the point, I hope this works!"
Priorities.
I've been lactose intolerant since my 40's. I'm also allergic to Penicillin as you mentioned about yourself. In your research, have you discovered any correlation with lactose intolerance, and allergies to an antibiotic such as Penicillin? I also suffered from Ulcerative Colitis with the result of losing my Colon in my late 20's. All three are probably inherited traits. Recently in my 60's, I discovered that I have a mutation called Factor 5 Leiden type one that allows my body to produce extra clotting factor in my blood. So now I take a blood thinner. (4 bad genes? pretty lucky guy---LOL !)
keep fighting the good fight ayy
still a wonderful channel years down the line
Cutting edge. Thank you for your service to humanity.
This man really just went into settings and turn off lactose intolerance
Did you know? “Bonjour!” means “hello!”
I hope something like this can be become available to the public soon. I’m extremely lactose and fructose intolerant and it is such a hinderance on my life. I’m wondering if this sort of research can be used to cure not only lactose intolerance but other food intolerances such as mine.
anybody else suddenly realising how far in "the future" we're living right now
This is awesome im so glad you're making videos on this in the way you are.
I have celiac disease, so this work is SUPER FREAKING EXCITING for me. I know what my immune system does is a lot more complicated than just prompting your body to start producing an enzyme that you used to make, but I hope that someday, it can be done. Even if I have to reup regularly, I'll freaking do it. I miss proper bread...
It's much easier to modify wheat to simply not cause allergy. There's a couple of groups working to make celiac free wheat. There's 2-3 small sections of the gluten proteins that can be removed without otherwise affecting the function of the protein, but makes it hypoallergenic.
Well done! That's incredibly useful. Thank you for your informative videos and scientific research. I hope to be able to do the same someday, and you are a fantastic inspiration!
As a lactose intolerant human, you are the chosen one. The beacon. Help us.
So, two things.
1) Awesome project. You put out such great quality conetent.
2) This will NEVER make it to people as a creative commons project. This is an unfortunately common misconception in the biomedical and pharmaceutical industry, and society at large. That giving away the secret sauce to a drug or therapy or solution or device will let everybody benefit from it. The opposite is true.
Because of our modern-day regulatory system, the biggest cost of any drug or therapy is the testing and clinical trial stage. This can costs millions or even tens or hundreds of millions of dollars depending, and maybe a tenth of new therapies make it through this stage to market. So figure anywhere from $50 million to $1 Billion to get a functional drug developed, certified and legal to sell.
And once you get it certified as safe - that's it. It's proven safe. So anyone can duplicate what you did, and they get to skip all those nasty clinical trials and all that expense. Testing a new drug or therapy or device constitutes a MASSIVE, UPFRONT, UNRECOVERABLE cost. So no one will EVER put that money forward to get it done, since they'll never get any of it back. Everyone will line up to be second, but no one will ever be first. That's why patents exist - so that people can exclusively sell something for a limited time as a monopoly so they have a chance at recovering all their development costs. No Patent = no recovery of costs = no one willing to pay those costs = no drug ever being developed, tested, and delivered to market.
Sorry, but that's just the truth of the matter. Any and all open-source medical therapies will never, ever get to be used by the general public. The best way to ensure the public has equal access is for someone private to maintain the rights, get a patent, go through the clinical trials, charge a seemingly absurd amount per unit so they can recover their costs (and thus satisfy the investors that agreed to foo the bill for the trials) and then let the public get limited access during the patent period, followed by widespread access once the patent expires and generic manufacturers drop prices down to consumer-grade levels. The only way this particular design of yours will ever reach people is if they explicitly disregard what you say and self-administer this therapy.
That's an interesting point I'd not heard before, but it does make a lot of sense.
@@jeffvader811 most people don't, which is why it has to be made explicit. University programs are often deliberate in making this point.
Going through some biomedical courses in college, all of the guest professors had stories about one project or another that they worked on, which was an effective therapy, which nobody ever got to use because they couldn't secure a patent for it, due to prior work or other considerations. No patent = no help to the public was something drilled into us.
This is why I think governments should make there own drug companies in order to help develop drugs like this that are good for society but not market viable.
Yes systematically speaking this is correct.
But the market is the market, if someone DIY's a real solution, there will be people monetizing it minus the upfront costs. After all, if we assume no problem with the technology and it is eventually accepted in limited fashion, there will be many many buyers and at that point, its supply versus demand. It will be expensive then before it gets cheap as with everything else.
I've been following this channel since the meat berry days and wow he still keeps blowing my mind
Really good and informative video!;)
Regarding your opening:
As a long time vegan, at this point naturally going lactose intolerant (like pretty much every adult mammal), I can very much relate to your anger about lactose in random food it has no place to be in. Not only is it the most common reason stuff isn't vegan but it's also extremely annoying, should I accidentally miss it on the label.
Do you try to eat vegan/ lactose free or don't care at all anymore and just rely on pills at this point?