R;N is such a great game in the SCIADV series. It's definitely downplayed alot, but it has a lot of uniqueness about it. One of my favorite cast of characters ever.
If Chaos;Child and and Robotics;Notes (And all VNs related to Steins;Gate) got localized, there’s still hope for Chaos;Head Noah, and maybe Occultic;Nine VN
Ocultic;Nine VN is insulting in it's current state. It was always that one weird entry that didn't started as a VN but a light novel for some reasons... As for Chaos;Head NoAH the translation team (Comitee of Zero) are doing great job at (finally) translateing it. Like really, they did one year worth of progress in ONE MONTH. I hope and believe that coronavirus isn't going to trash their plans.
@@4livetv934 Even If Occultic;Nine ended up being mediocre, I’ll still enjoy it either way, and from what I read of the light novel, it’s pretty interesting (i did watch the anime before hand), and Chaos;Head Noah fan translation progressive is great to see, I don’t mind being PC as long I’m able to enjoy it like vanilla Chaos;Head VN did
To all SciADV fans here, Anonymous;Code is coming this fall. Chiyo (Main Writer of SciADV Series) told us that it will be the culmination of the SciADV series, remember to check it out.
I’ve been making my way through the game slowly ever since this video came out. Just made it to sequence 10 today! I watched the anime when it came out but forgot almost everything other than the cliff scene.
I watched your Chaos;Child video and bought the game and loved it, also cried a few times. It's the best VN I've played so far. I'm trusting you again.
Thank you for putting your trust in me! R;N is a very different beast but it still has its dark and emotional moments that are very SciADV. I wasn’t expecting to love this game so much.
Very well done! I saw how much effort you put into this video on Twitter and Twitch and man was it worth it! Such a great and informative video! Keep it up :)
I cared so much that I preordered it a few months back. Already platinum the elite and now I'm working on dash. Elite ads so much more that the anime left out or changed. Dash so far is pretty darn good but it's more about fun and service but that's part of its charm.
Started R;N two days ago with a friend of mine, after a year after buying the game when it has released and three years after I watched the anime. We've read only the first hour but I already love it.
Kai is legit feel like different characters from anime just from phase one i already invested in him than i did in entire anime lol, so did other character too Akiho especially The scene where Akiho having an attack in parking lot convey how good and deep the relationship between those two have so much it made me so emotional and that's phase one! I'm so impressed "Kai...my son" Indeed!
There are so many AMAZING Kai moments the anime just sucks all the nuance out of its nutsssss. I felt nothing about him with the anime, it sucks how poorly it does him justice. He and Aki have great character scenes near the end, I hope you continue to enjoy!
I was on the fence about getting this double pack but you convinced me (for switch likely). I definitely want to play this visual novel since I love Steins;Gate (both VN and anime), but was worried I wouldn't be able to make time for it (CS4 coming out soon which will absorb me). I recently picked up Chaos;Child for Vita and feel that I'm this far into the Science Adventure series that I want to fully invest in it :). Your passion for the series pushed me to get into the series past Stein;Gate and I thank you for it. I've enjoyed you're content (regardless if it's SciADV related) and look forward to your future content. -Danny
hey man, watched your chaos;child video and became a fan, now you've got me so excited about ROBOTICS;NOTES and I haven't even watched your video. I feel like a question would be nice, so favorite SciADV character, One Male and One Female. Cuz why not
Ohhhh this is super evil. I want to just say Kai and Akiho because they're so fresh, but its probably Kai and Serika? The main male and female of all the games are so good its harddd
@@culIen in SciADV they seem to always try and make an interesting protag at least. I do think the Kill Ballad policy thing is a bit of a asshole thing to keep doing. Really making me look foward to the character development
new viewer, started this series with steins;gate and then zero, absolutely loved them both. I have Chaos; Child but was on the fence about getting Robotics:Notes. and then now i wasn't lmao after this vid I sped towards the eshop and sure enough had a launch discount and some spare coins to make buying both digitally much cheaper. i still want to play chaos:head but I might just bite the bullet and play Child first instead.... but anyway, thanks so much! I now have two new vns waiting for me :)
I really recommend playing Head before child, or at least watching a youtube playthrough if you aren't a fan of reading VNs on PC. Child's last segment will be very confusing without ;Head. I hope you enjoy R;N!
your videos are always the best to get me hyped for another game. i already watched the anime for robotics;notes and can't wait to play these two games next :D
Half a year later, I've finished R;N. I have very mixed feelings about it as long as many problems with some things in it but still. Thanks, Cullen, vid is awesome
Dude, I just saw Robotics;Notes for sale on Switch and thought "Hm, I don't know much about this series, but I know Cullen had some videos on the other SciADV games. Wonder if he has any on these games". And then, there it is in my sub box.
Spike releasing this on a NUTS launch discount of $25 each is such a steal. I had to work my butt off to get this out (and I missed the launch date!) but it was worth it because I loved this game so much
This is a really great video man, I've only seen the anime of Steins;Gate and Zero several times and own Steins;Gate Elite but haven't touched it yet. Been meaning to dive into this series proper (which I now know is called SCIADV thinks to you) but kind of put it off a while. But with the news of a new Steins;Gate game on the way and your video I felt was the motivation I need to get started on it. I assume Chaos;Head NoAH is the proper start of the series so I'll start there.
Thank you for your kind words!!! I certainly tried my best on it ^-^ Chaos;Head NoAH is definitely the best place to start as long as you can read Japanese. If not, the Steins;Gate VN has plenty of fun surprises for those who have only seen the anime. Hope you enjoy your time with the series!
I'm just here to say thank you for getting me into SciAdv... I already knew about Steins;Gate but the rest of the series was blind to me. Thanks for getting me into the rest of the series. Massive SciAdv spoilers bellow because I'm here's my heavily biased 'awards' to characters / stories. Favorite Male Character: Kai or Takaru (I can't decide) Favorite Female Character: C H R I S T I N A Favorite Antagonist: Serika (by a landslide) Characters that deserves more love: Maho , Subaru, Nono / Senri Character that annoyed me the most: Takumi Character that got redeemed the most: (also) Takumi Biggest oof moment: "I don't know you" : Chaos;Child Biggest WTF moment: Okabe going crazy in the Suzaha end Most hype moment: Everybody joining together to remake Gunbuild MK 1 Most touching moment: Kai helping Aki out after she get's an attack Thing that surprised me the most: Basically any major reveal in the Chaos; series Favorite Ship: Okabe and Kurisu Favorite OST: Steings;Gate OST since the music gets stuck in my head too much Most Hype Ost: Robotic;Notes Favorite true ending: ...I have no clue, it's all pretty good Least favorite true ending: Chaos;Head (the ending is good but there's no epilogue so it looses points there) Favorite alternative ending: Real Sky End (Nono / Senri) Least favorite alternative ending: either Feris end or Ruka end... both kind of feel like filler Favorite bad end: Ditching Aki by defeating her in the game (ha ha ha...) Best implentation of choice system: Cellphone calling in Steins;Gate (more like Steins;Gate 0 since it is more streamlined to get true end but I am biased) Favorite SciAdv story: Chaos;Child Least Favorite SciAdv story: Occult;Nine (not bad, but there's much better) SciAdv game I'm most mixed about: Chaos;Head. SciAdv game I'm looking most foward to: Anomymous;Code Best overall cast: Robotic;Notes (nobody is filler and is consitently good) Worst overall cast: Chaos;Head (unfair since Chaos;Head NOah isn't out, and the main focus isn't on the cast, but hey) ...and that is my terrible oppnion.
Finally, the only two (main) SciADV games I haven't played yet. I already watched and liked the R;N anime, but I've heard that , just as every other SciADV adaptation other than Steins;Gate, it's not as good as the VN.
@@culIen Bought it yesterday and I've been reading it for a few hours. I can't believe I just now finished Phase one and got the op. This is going to be a long one. And I must admit, being able to read his thoughts makes Kaito a much better character than his anime version. It was the same about VN Okabe compared to anime Okabe, but I think in the S;G anime they did a much better job showing us how he felt and what he thought through his expressions and the way he talked.
@@madengineerkyouma The thing about S;G is that Okabe is a lot more outspoken than most VN protags. (Definitely way more than Okabe or Kai were) so it's very easy to convey how he feels + his development in anime format, whereas Takumi/Kai's developments are mostly internal so those would be incredibly hard to portray in an anime. Okabe just got lucky really.
Oh, you said you'd make a video about R;N DaSH, so I wonder if that's still in the cards? I feel my enjoyment would've been improved if I knew it was more like a fandisk from the beginning
One of these days! I'm very interested in discussing the various versions, but I think I will wait until Steins;Gate 0 Elite comes out to do so to see if it combines the best aspects of both the anime and the VN
I decided to pick up the double pack on steam, so it's good to have it at the ready. The thing is, I'll probably not touch it for a long while, as I'll be waiting patiently for Committee of Zero's work on Chaos;Head Noah before I get back to tackling this series for real. Admittedly I have watched the Steins;Gate anime and I've also gotten about 9 hours in Chaos;Child (which has probably been a year ago oops), but I'll probably end up going in release order once I'm able to. Certainly looking forward to that day!
Thats a great idea! Chaos;Head NoAH is going to be soooo good, I'm excited! Thank you for supporting the series in the west, even if you aren't playing it right away! I wish I could go back and play them all in release order lol
It's fine to just read the original Chaos;Head novel. The only thing that Noah adds are other routes that are not even that long and obviously not canon, and while there's some bits of interesting information here and there, it's nothing that you need to know to read Chaos;Child or Robotics;Notes.
One day, when Steins;Gate 0 Elite comes out and hopefully pulls everything good from the new anime content and the VN branching story, I'll make a video going in depth...
As a S;G only, you convinced me not only to care about R;N but to buy it on Steam. Congrats 😉 Also, Backlog Battle sent me from his year end video, and I agree with your GOTY pick: I also only played DQ 11 for the first time this year, loved it and NEED to play the rest 🙂
I’ve been waiting for this video! I mean I already care about the SciAdv series and I already have the game but I want to hear other people rant about how good these games are, dammit!
Thanks, man. I was hesitant, should I even try that game. So I've watched your vids and I've cried through s:g + s;g 0 and now I'm going through Chaos Child. None of the other reviewers mentioned the themes, that really matters in those VNs. Love your vids, keep it up. Tuturuu!
Thank you!!!!! I know I was hyping it up a lot but that's because even I could tell I outdid myself rjfjfjfjfjrjfjjr no idea how to top it, but I'm going to try!
Goddammit. JUST LAST NIGHT, I bought Ys VIII and IX because of your videos. And three seconds ago, I bought this double pack as well. :D (Then again, I've got quite an expansive Steins;Gate collection as well, so I guess Robotics;Notes was just a matter of time.) One question: Is there no English version of either Chaos;Head Dual or Chaos;Child yet (the VNs I mean, of course)?
QUESTION TO ANYONE WHO HAS READ THIS...... I read a lot of visual novels and I usually read through the first time without a guide and see where I end up, but I've heard this one is more complicated and you should use a guide even the first time. Question is, if you have read through this already, would you recommend using a guide the first read through or just go in cold?
I mention this in the video, but thankfully you can play pretty lax up to your first ending. After that you unlock the ability to play the next chapters, and because they are all canon and sequential it is possible to play them out of order. In the description I mention the order you should attempt to unlock them, and in the video I provide the date you should revisit to start making your tweeps count if you want to figure out how to unlock them on your own ^-^ I hoped this helped at all!
Ok i'm hyped. But before that, couple of words. Probably too many. Cullen, i've subscribed and followed your channel roughly for a year now. Rather inconsistently, but still. And i have to say, this is one of the better videos in this style i've seen for a more than a while, and most likely one of the best from you. Points you needed and wanted to get across came clear even for a foreigner like me, comedic bits really satisfied my degenerate brain and you also conveyed emotions you felt and probably/hopefully many others will feel while playing this game, at least in my opinion. So...congrats for the end result, thank you for hard work and keep it cool. 👊 Now back to being hyped. Since this video seemed succesful and made me care to try this, i have one question though, which either you or anyone reading this and familiar with the series can answer. Ok? Ok. So: I am complete noob when it comes to these games, and want to start my journey through them with Elite. But since Dash is direct to sequel not only that but Steins; Gate (and maybe other games? Sorry, too much write and short memory), i feel like i could at least play that since it has seen to be interesting. Not as interesting as these games, though. Is it okay to start with Elite, go back to Steins; Gate (and possibly other games if i get hooked) and then jump back to Dash or does it make my experience...not confusing, but maybe little odd? I know this maybe a little strange question, but i want to make sure i have the best experience possible if i end up loving Elite or any of the other games. That's why after Trails Of Cold Steel 1&2, i plan to go back to Sky trilogy and Crossbell games before playing Cs 3&4 (boy, that gonna be a ride, ain't it?). Anyways, that was my question and... oh frick, i wrote an essay again. Oh well. Again, thank you Cullen for this video, both you and rest of the audience have a good weekend and great halloween, will ya. See you around 👋
Thank you SO MUCH for this. I avoided comments for a bit because the positive feedback was OVERWHELMING and made me super emotional. This absolutely made my day, thank you SO MUCH ;-; On to your question, I think you can ABSOLUTELY play R;N Elite, play Steins;Gate, and then play DaSH. R;N is standalone enough to not NEED anything else but DaSH will make no sense without S;G because it expects you to know about Daru. If you have any questions (or i forgot to address anything) let me know!!!
@@culIen glad to hear that =) Thanks for the answer, now i know what to do. I don't have anymore questions for now, but i will let you know if or definitely when i get to play R;N Elite and how i feel about it after completion. Until then, cheers.
McB one Very important thing to note is that R;NE need Knowledge from both C;H and S;G Visual novels as R;NE contains major references that u won’t understand until u play these two games from what I’ve heard from the ppl who played the game so its “highly” recommended to play these 2 games before hopping into Both R;NE/Dash. Hope this helps
One more thing to add: C;H is not localized, but there is a fan patch for PC in the SciADV subreddit discord server here you can join in with this linkdiscord.com/invite/YBmZzfA and follow the instructions to download the first SciADV entry!
Well, I just started, and I'm not hyped by Kai as a main character. For now. I don't see him being superior as Rintaro, but I do remember hating Rintaro at the beginning. Anyway, I don't feel it is a slow start. It feels faster than Steins;Gate. Also thanks to you, I understand how Twipo is supposed to work. I was waiting for the game to actively ask me to reply.
Kai is absolutely a slow burn a lot of people might not like, just bear with him and be open minded to how his character subtly starts to develop. He's completely unique to the SciADV main protagonists, and imo his payoff is worth it. Glad I helped you figure out twipo, it does a kinda bad job explaining it :P
I've gotta admit, I'm still in Phase 2 but MAN the anime did NOT do this game justice. Don't get me wrong, I love the anime still, it's really good IMO but the game explains so much more and it proves why the length is good. It doesn't waste your time, it's actually giving you the perfect amount of everything so you can actually understand the characters, events, and just everything so far. Talking about how the SG0 anime is better than the VN and saying "we're not ready to have that discussion yet" is also a point I HEAVILY agree on and I have gotten CRAP for it! Anyway, Robotics;Notes' anime was actually my favorite, even topping Steins;Gate (maybe SG0 tying with it as I like SG0 more than the OG SG) and playing the game just enforces my liking R;N the best. The only thing I have to mention that I don't like is the marketing of this game... "Heroes don't save the world, otakus do!" That's... that's going to be a meme, and not for nice reasons.......... Honestly..... I think this is one game that can appeal to anyone and everyone yet they have to pander to people who would be considered "anime weirdos" and I really don't think I like it. Didn't like it since the first reveal trailer of Double Pack, and I don't like it still with it being ON THE BACK OF THE GOSH DANG BOOOOOOX! Reminds me of Mighty No. 9's "make the bad guys cry like an anime fan on prom night"... Maybe not as bad but in the same vein... Anyway thanks for the video, and I think I will show this to people who aren't interested in R;N like they were with S;G. PS: That comment about how it got a T rating... I agree. What the heck? I feel ESRB is weird with ratings sometimes. Also "Frau alone should have made it an M rating" AGREED. 100% AGREED AND I'M JUST GOING OFF THE ANIME AT THIS POINT. The "holy shit is that translated?" comment about the Tanegashima Map was epic, and btw I think IRUO. is pronounced EE-RU-OH.
@@kusamaID I recommend this order (Release order): If you know Japanese or Spanish (Spanish for Noah + LCC): Chaos;Head Noah > Chaos;Head Love Chu Chu! > Steins;Gate (Elite) > Robotics;Notes (Elite) > Chaos;Child > Chaos;Child Love Chu Chu!! > Steins;Gate 0 > Robotics;Notes DaSH Only English: Chaos;Head > Steins;Gate (Elite) > Robotics;Notes Elite > Chaos;Child > Steins;Gate 0 > Robotics;Notes DaSH (Note: All SciADV are different games with different themes, they are not Steins;Gate)
I’ve played Chaos;Child but not Chaos;Head, should I hold on Robotics;Notes and finish Chaos;Head, or will I be fine? (I’ve done both Steins;Gate games too)
Nah, my opinion is don't waste time on Chaos;Head where is a matter of time to get the complete edition Chaos;Head NoAH translated. You would need to read again the same once NoAH will come out.
@@4livetv934 Yea but you don't need NoAH exclusive content for R;N or C;C, so original Chaos;Head is enough for both. NoAH fan port will take a year to come out.
Its so hard tbh, because before I played it and just watched the anime it was at the bottom. But now I honestly think there is no "bad" mainline entry. C;H, S;G, R;N and C;C are all amazing games with different pros and cons. R;N is just the most consistent in the series imo, so in some ways I kind of think its one of the better games.
What I really hate about Steins;Gate is the system of player choices which is not transparent and ultimately leads to a necessity of reading and following the guide. I recently finished that game, learning later that there is a "true ending" which is accessible by following a series of exact choices hidden behind text-message replies which player has no chance to find in other way than using tedious try/error approach. And now I've learned that Robotics;Notes uses even more complex system of some "online message boards"? Reviewer even says that it's not a shame to follow a guide... It's no good :-(
Its very much worth it to see the true ending of S;G, its a masterpiece in every sense of the word. R;N is actually a lot more simpler than S;G, since once you get all the routes you can just play the true end arc on the menu. All these games have obtuse route systems, but its worth it because the stories are so great.
Robotics;Notes ELITE was amazing! But I just finished DaSH and am very curious to hear what you have to say about it, because I was not impressed... Edit: It was advertised as a mainline entry, and I guess it technically is, but it's more of a fandisk/side story. So it's best to go in with that mindset
I'm chipping away at it, and will work on my video when I finish :V Its definitely not as consistent as Elite, but I can see a lot of heart in it so far.
Woah, woah, woah. You NEED to back up that steins;gate 0 claim. Please, my king, how in the world do you find the anime better than the vn? No, im not bitter my favorite scenes were cut out. I want to see Okabe drive and the anime didnt include it so it was infinitly worse!
@@culIen My opinion on 0 is that the VN is overall better, mostly because of the alternate endings that were cut, but episode 8 and pretty much the whole final arc (except the pretty pathetic fight between Suzuha and the soldiers) is pretty much the best content in the whole franchise.
@@madengineerkyouma yeah that's super valid, I just have some issues with the content in those and feel the execution is messy in the VN. The anime fixed that AWFUL kagari twist, and that was enough for me haha
@DrCullenPHD Yeah, Kagari is one thing the anime improved a lot. Also, even though I thought he was good in the VN, Daru is Godlike in the anime. Best friend, best dad, best hacker. What I mostly missed in the anime was Maho's ending, specially what happens to Moeka, since her friendship with Maho was pretty much non-existent in the anime and so was Reyes' involvement in the plot. Also, I think the Hououin Kyouma revival scene works a bit better with the whole gang together and Suzuha punching Okabe instead of Daru.
this is a really good video, but I would prefer you to not show the line "whose eyes those are" being mentioned in the game, since I wanted to get surprised whenever it comes down to that line.
It shows up in the roughly the first 30 minutes to an hour, and not really again, so I made the call to show it since I wanted to show off the new translation of it. Apologies :(
god the bit about the map being translated is GOLD
BY THE GODS!! They actually did it!!!
Is that still not translated in chaos child?
@@kingdomkey63 nope, still untranslated...
@@kingdomkey63 Nope, unless you use the fan mod to fix the TL
It was not translated in C;C in order to get people hyped to have it translated in R;N. It was a conspiracy ALL ALONG!
I could watch you gush about visual novels forever tbh
If I can, I'd love to gush about VNs forever ^-^
SAME!
R;N is such a great game in the SCIADV series. It's definitely downplayed alot, but it has a lot of uniqueness about it. One of my favorite cast of characters ever.
If Chaos;Child and and Robotics;Notes (And all VNs related to Steins;Gate) got localized, there’s still hope for Chaos;Head Noah, and maybe Occultic;Nine VN
Ocultic;Nine VN is insulting in it's current state. It was always that one weird entry that didn't started as a VN but a light novel for some reasons...
As for Chaos;Head NoAH the translation team (Comitee of Zero) are doing great job at (finally) translateing it. Like really, they did one year worth of progress in ONE MONTH. I hope and believe that coronavirus isn't going to trash their plans.
I hope we get the Occultic;Nine VN when its finally finished just to experience the mess first hand, but I really hope more than anything we get NoAH.
The real question is: Will we ever get an official localization of Steins;Gate 8-bit, the best and most important entry in the series, on PC?
They translated Takumi as some other name. C;H can apparently never come over officially
@@4livetv934 Even If Occultic;Nine ended up being mediocre, I’ll still enjoy it either way, and from what I read of the light novel, it’s pretty interesting (i did watch the anime before hand), and Chaos;Head Noah fan translation progressive is great to see, I don’t mind being PC as long I’m able to enjoy it like vanilla Chaos;Head VN did
I already DO care, but somehow I feel like I'll care more after watching this :)
Edit: confirmed, it is indeed time for robots
IT SURE IS
WE MOVE
the sunglasses bit made me laugh out loud for the first time in like a month thank you
Awwww thank you. Hope things are going well, stay strong!
@@culIen oh everything’s totally cool! just, you know, those 2020 vibes. thank you though, i appreciate it.✨
@@gaycosmichorror oh lord you absolutely know I do. Been hard to find motivation to do anything. Stay safe :V
@@culIen ugh, i feel that. thanks, and you hang in there too.
To all SciADV fans here, Anonymous;Code is coming this fall. Chiyo (Main Writer of SciADV Series) told us that it will be the culmination of the SciADV series, remember to check it out.
I’ve been making my way through the game slowly ever since this video came out. Just made it to sequence 10 today! I watched the anime when it came out but forgot almost everything other than the cliff scene.
your recommendations are always 110% kino. bought the double pack today, can't wait to play them ! great video as always
Amazing video man! Hopefully Spike will see all the positive reception and be convinced to bring over the C;H games too!
Dang, didnt know about the double pack.. ended up buying only the DaSH ver..
I watched your Chaos;Child video and bought the game and loved it, also cried a few times. It's the best VN I've played so far.
I'm trusting you again.
Thank you for putting your trust in me! R;N is a very different beast but it still has its dark and emotional moments that are very SciADV. I wasn’t expecting to love this game so much.
Very well done! I saw how much effort you put into this video on Twitter and Twitch and man was it worth it! Such a great and informative video! Keep it up :)
i am angry this doesnt have more views
shouldve said steins;gate a few more times
You can't win them all..
Just imagine KiryuAtTheBar.png
I cared so much that I preordered it a few months back. Already platinum the elite and now I'm working on dash. Elite ads so much more that the anime left out or changed. Dash so far is pretty darn good but it's more about fun and service but that's part of its charm.
IIIIIIIMMMMMPAAAAACCCCCTOOOOOOOOOOOO
IIIIMMMMMMMMMMMPAAAAAAACCCCCCCCCTTTTTTOOOOOOOOOOOOOOOOOOOOO
Started R;N two days ago with a friend of mine, after a year after buying the game when it has released and three years after I watched the anime. We've read only the first hour but I already love it.
Kai is legit feel like different characters from anime just from phase one i already invested in him than i did in entire anime lol, so did other character too Akiho especially
The scene where Akiho having an attack in parking lot convey how good and deep the relationship between those two have so much it made me so emotional and that's phase one! I'm so impressed
"Kai...my son" Indeed!
There are so many AMAZING Kai moments the anime just sucks all the nuance out of its nutsssss. I felt nothing about him with the anime, it sucks how poorly it does him justice. He and Aki have great character scenes near the end, I hope you continue to enjoy!
alright, time to walk to the cliff with my robotic legs and play the game
I was on the fence about getting this double pack but you convinced me (for switch likely). I definitely want to play this visual novel since I love Steins;Gate (both VN and anime), but was worried I wouldn't be able to make time for it (CS4 coming out soon which will absorb me). I recently picked up Chaos;Child for Vita and feel that I'm this far into the Science Adventure series that I want to fully invest in it :).
Your passion for the series pushed me to get into the series past Stein;Gate and I thank you for it. I've enjoyed you're content (regardless if it's SciADV related) and look forward to your future content. -Danny
hey man, watched your chaos;child video and became a fan, now you've got me so excited about ROBOTICS;NOTES and I haven't even watched your video. I feel like a question would be nice, so favorite SciADV character, One Male and One Female. Cuz why not
Same here his C;C video budged me on getting it and I became a fan cause I loved it
Ohhhh this is super evil. I want to just say Kai and Akiho because they're so fresh, but its probably Kai and Serika? The main male and female of all the games are so good its harddd
@@culIen wow, cant go wrong with Serika ever. Looking foward to finding out whats so great about kai then
@@complexstupidity9758 Kai is a very different kind of protagonist than the rest but his development is really good. He's a good boy, my son...
@@culIen in SciADV they seem to always try and make an interesting protag at least. I do think the Kill Ballad policy thing is a bit of a asshole thing to keep doing. Really making me look foward to the character development
This game has such a slow start that I almost gave up on it several times. I just reached the second phase and I think it finally clicked with me.
CULLEN UPLOADS ANOTHER MASTAPEECE
Ive had a passing interest in sciadv games but hot damn you SOLD me on this. Amazing video, arguably your best!
Eyyyy that's awesome! I hope you enjoy your time with these games!
Always a joy when you upload
Thank you, always a joy to get feedback!
new viewer, started this series with steins;gate and then zero, absolutely loved them both. I have Chaos; Child but was on the fence about getting Robotics:Notes. and then now i wasn't lmao after this vid I sped towards the eshop and sure enough had a launch discount and some spare coins to make buying both digitally much cheaper. i still want to play chaos:head but I might just bite the bullet and play Child first instead....
but anyway, thanks so much! I now have two new vns waiting for me :)
I really recommend playing Head before child, or at least watching a youtube playthrough if you aren't a fan of reading VNs on PC. Child's last segment will be very confusing without ;Head. I hope you enjoy R;N!
@@culIen I did find a fan translated version of Chaos Head after posting this, so no worries there! thank you!
your videos are always the best to get me hyped for another game. i already watched the anime for robotics;notes and can't wait to play these two games next :D
I hope Elite manages to surprise you even having seen the anime, just like it did me!
Half a year later, I've finished R;N. I have very mixed feelings about it as long as many problems with some things in it but still. Thanks, Cullen, vid is awesome
That goddamn "Let Me Pass" in the intro though... ...
*EDIT:* or wait is it kagome kagome. hm.
That was indeed Kogome Kagome ^-^
I love adding fun little details like that to these heh
Dude, I just saw Robotics;Notes for sale on Switch and thought "Hm, I don't know much about this series, but I know Cullen had some videos on the other SciADV games. Wonder if he has any on these games". And then, there it is in my sub box.
Spike releasing this on a NUTS launch discount of $25 each is such a steal. I had to work my butt off to get this out (and I missed the launch date!) but it was worth it because I loved this game so much
This is a really great video man, I've only seen the anime of Steins;Gate and Zero several times and own Steins;Gate Elite but haven't touched it yet. Been meaning to dive into this series proper (which I now know is called SCIADV thinks to you) but kind of put it off a while. But with the news of a new Steins;Gate game on the way and your video I felt was the motivation I need to get started on it. I assume Chaos;Head NoAH is the proper start of the series so I'll start there.
Thank you for your kind words!!! I certainly tried my best on it ^-^
Chaos;Head NoAH is definitely the best place to start as long as you can read Japanese. If not, the Steins;Gate VN has plenty of fun surprises for those who have only seen the anime. Hope you enjoy your time with the series!
I'm just here to say thank you for getting me into SciAdv... I already knew about Steins;Gate but the rest of the series was blind to me. Thanks for getting me into the rest of the series. Massive SciAdv spoilers bellow because I'm here's my heavily biased 'awards' to characters / stories.
Favorite Male Character: Kai or Takaru (I can't decide)
Favorite Female Character: C H R I S T I N A
Favorite Antagonist: Serika (by a landslide)
Characters that deserves more love: Maho
, Subaru, Nono / Senri
Character that annoyed me the most: Takumi
Character that got redeemed the most: (also) Takumi
Biggest oof moment: "I don't know you" : Chaos;Child
Biggest WTF moment: Okabe going crazy in the Suzaha end
Most hype moment: Everybody joining together to remake Gunbuild MK 1
Most touching moment: Kai helping Aki out after she get's an attack
Thing that surprised me the most: Basically any major reveal in the Chaos; series
Favorite Ship: Okabe and Kurisu
Favorite OST: Steings;Gate OST since the music gets stuck in my head too much
Most Hype Ost: Robotic;Notes
Favorite true ending: ...I have no clue, it's all pretty good
Least favorite true ending: Chaos;Head (the ending is good but there's no epilogue so it looses points there)
Favorite alternative ending: Real Sky End (Nono / Senri)
Least favorite alternative ending: either Feris end or Ruka end... both kind of feel like filler
Favorite bad end: Ditching Aki by defeating her in the game (ha ha ha...)
Best implentation of choice system: Cellphone calling in Steins;Gate (more like Steins;Gate 0 since it is more streamlined to get true end but I am biased)
Favorite SciAdv story: Chaos;Child
Least Favorite SciAdv story: Occult;Nine (not bad, but there's much better)
SciAdv game I'm most mixed about: Chaos;Head.
SciAdv game I'm looking most foward to: Anomymous;Code
Best overall cast: Robotic;Notes (nobody is filler and is consitently good)
Worst overall cast: Chaos;Head (unfair since Chaos;Head NOah isn't out, and the main focus isn't on the cast, but hey)
...and that is my terrible oppnion.
Finally, the only two (main) SciADV games I haven't played yet.
I already watched and liked the R;N anime, but I've heard that , just as every other SciADV adaptation other than Steins;Gate, it's not as good as the VN.
Oh for sure. I was expecting to get bored of the VN because I also had experience with the anime but I was HOOKED for two weeks straight
@@culIen Bought it yesterday and I've been reading it for a few hours. I can't believe I just now finished Phase one and got the op. This is going to be a long one. And I must admit, being able to read his thoughts makes Kaito a much better character than his anime version.
It was the same about VN Okabe compared to anime Okabe, but I think in the S;G anime they did a much better job showing us how he felt and what he thought through his expressions and the way he talked.
@@madengineerkyouma The thing about S;G is that Okabe is a lot more outspoken than most VN protags. (Definitely way more than Okabe or Kai were) so it's very easy to convey how he feels + his development in anime format, whereas Takumi/Kai's developments are mostly internal so those would be incredibly hard to portray in an anime. Okabe just got lucky really.
Oh, you said you'd make a video about R;N DaSH, so I wonder if that's still in the cards?
I feel my enjoyment would've been improved if I knew it was more like a fandisk from the beginning
It is still in the cards for sure! Just needed some time away from SciADV. The plan is late this year/early next. Separates me from the hype a lot
Lmao just like AI the Somnium files you convinced me to buy this lmao can't wait to play
Eyyyyy love to hear it. Hope you enjoy your time with these awesome games ^-^
I would really like to see this Steins;Gate 0 video. You're the first person I've seen who also thinks the SG0 anime is really good.
One of these days! I'm very interested in discussing the various versions, but I think I will wait until Steins;Gate 0 Elite comes out to do so to see if it combines the best aspects of both the anime and the VN
I just finished r;n elite today, it is properly my favorite game in the series
I decided to pick up the double pack on steam, so it's good to have it at the ready.
The thing is, I'll probably not touch it for a long while, as I'll be waiting patiently for Committee of Zero's work on Chaos;Head Noah before I get back to tackling this series for real. Admittedly I have watched the Steins;Gate anime and I've also gotten about 9 hours in Chaos;Child (which has probably been a year ago oops), but I'll probably end up going in release order once I'm able to. Certainly looking forward to that day!
Thats a great idea! Chaos;Head NoAH is going to be soooo good, I'm excited! Thank you for supporting the series in the west, even if you aren't playing it right away! I wish I could go back and play them all in release order lol
It's fine to just read the original Chaos;Head novel. The only thing that Noah adds are other routes that are not even that long and obviously not canon, and while there's some bits of interesting information here and there, it's nothing that you need to know to read Chaos;Child or Robotics;Notes.
That's it, I'm absolutely buying this one too. Also please do go on about why Steins;Gate 0's anime is better than the VN, I just bought it
One day, when Steins;Gate 0 Elite comes out and hopefully pulls everything good from the new anime content and the VN branching story, I'll make a video going in depth...
Already bought both games on release but I watched this great review anyway
Thank you so much, hope you're loving the games ^-^
Love all the SciADV videos! The series is really underappreciated outside of steins;gate.
Goddamn this is the funniest and best edited review so far
YOOOOOOOOOO You did a fantastic job here holy shit
Damn, didn't know this was a video game, I watched the anime that came out also in 2012 and i loved it.
Already pre-ordered back when they made it available. Not my favorite practice, but if It will help Robotics;Notes then I will.
Got the double pack for 28 can't wait
As a S;G only, you convinced me not only to care about R;N but to buy it on Steam. Congrats 😉
Also, Backlog Battle sent me from his year end video, and I agree with your GOTY pick: I also only played DQ 11 for the first time this year, loved it and NEED to play the rest 🙂
Well your gushing convinced me to buy it
“Or, SciADV (I’m not gonna call it that!)” 😂😂😂 made me literally LOL
I’ve been waiting for this video! I mean I already care about the SciAdv series and I already have the game but I want to hear other people rant about how good these games are, dammit!
I need to get these.
Heck yeah you do! They're so good!!!!!!
Damn, I cant watch this until forever
Its okay, only you will understand the feeling I felt while making it of not being able to see the finished project forever 💖
@@culIen meh, it's not a big deal. Just gotta wait until I play the day one edition I just bought
Been waiting for these games for ages, so hyped to play them!
Thanks, man. I was hesitant, should I even try that game. So I've watched your vids and I've cried through s:g + s;g 0 and now I'm going through Chaos Child. None of the other reviewers mentioned the themes, that really matters in those VNs. Love your vids, keep it up. Tuturuu!
It's highly recommended to read Chaos;Head before R;N (and especially Chaos;Child, but I'm too late to warn you there.)
20XX:Why You Should Care:Chaos;Head Dual
cullen sells me on all the sci adv games... it's not fair uwu
Fucking amazing video! Waited and didn't get disappointed. Continue to make vids, love them all
Thank you!!!!! I know I was hyping it up a lot but that's because even I could tell I outdid myself rjfjfjfjfjrjfjjr no idea how to top it, but I'm going to try!
Goddammit. JUST LAST NIGHT, I bought Ys VIII and IX because of your videos. And three seconds ago, I bought this double pack as well. :D (Then again, I've got quite an expansive Steins;Gate collection as well, so I guess Robotics;Notes was just a matter of time.) One question: Is there no English version of either Chaos;Head Dual or Chaos;Child yet (the VNs I mean, of course)?
Chaos;Head has a fan translation in the work, and Chaos;Child has an official English release!
Thank you again for the kind words and support uOu
QUESTION TO ANYONE WHO HAS READ THIS...... I read a lot of visual novels and I usually read through the first time without a guide and see where I end up, but I've heard this one is more complicated and you should use a guide even the first time. Question is, if you have read through this already, would you recommend using a guide the first read through or just go in cold?
I mention this in the video, but thankfully you can play pretty lax up to your first ending. After that you unlock the ability to play the next chapters, and because they are all canon and sequential it is possible to play them out of order. In the description I mention the order you should attempt to unlock them, and in the video I provide the date you should revisit to start making your tweeps count if you want to figure out how to unlock them on your own ^-^
I hoped this helped at all!
Just bought R;N double pack for $45CAD. Steal. Can't wait to finally experience these stories.
Ok i'm hyped. But before that, couple of words. Probably too many.
Cullen, i've subscribed and followed your channel roughly for a year now. Rather inconsistently, but still. And i have to say, this is one of the better videos in this style i've seen for a more than a while, and most likely one of the best from you. Points you needed and wanted to get across came clear even for a foreigner like me, comedic bits really satisfied my degenerate brain and you also conveyed emotions you felt and probably/hopefully many others will feel while playing this game, at least in my opinion. So...congrats for the end result, thank you for hard work and keep it cool. 👊
Now back to being hyped. Since this video seemed succesful and made me care to try this, i have one question though, which either you or anyone reading this and familiar with the series can answer. Ok? Ok. So:
I am complete noob when it comes to these games, and want to start my journey through them with Elite. But since Dash is direct to sequel not only that but Steins; Gate (and maybe other games? Sorry, too much write and short memory), i feel like i could at least play that since it has seen to be interesting. Not as interesting as these games, though. Is it okay to start with Elite, go back to Steins; Gate (and possibly other games if i get hooked) and then jump back to Dash or does it make my experience...not confusing, but maybe little odd?
I know this maybe a little strange question, but i want to make sure i have the best experience possible if i end up loving Elite or any of the other games. That's why after Trails Of Cold Steel 1&2, i plan to go back to Sky trilogy and Crossbell games before playing Cs 3&4 (boy, that gonna be a ride, ain't it?).
Anyways, that was my question and... oh frick, i wrote an essay again. Oh well.
Again, thank you Cullen for this video, both you and rest of the audience have a good weekend and great halloween, will ya. See you around 👋
Thank you SO MUCH for this. I avoided comments for a bit because the positive feedback was OVERWHELMING and made me super emotional. This absolutely made my day, thank you SO MUCH ;-;
On to your question, I think you can ABSOLUTELY play R;N Elite, play Steins;Gate, and then play DaSH. R;N is standalone enough to not NEED anything else but DaSH will make no sense without S;G because it expects you to know about Daru. If you have any questions (or i forgot to address anything) let me know!!!
@@culIen glad to hear that =)
Thanks for the answer, now i know what to do. I don't have anymore questions for now, but i will let you know if or definitely when i get to play R;N Elite and how i feel about it after completion. Until then, cheers.
McB one Very important thing to note is that R;NE need Knowledge from both C;H and S;G Visual novels as R;NE contains major references that u won’t understand until u play these two games from what I’ve heard from the ppl who played the game so its “highly” recommended to play these 2 games before hopping into Both R;NE/Dash. Hope this helps
One more thing to add: C;H is not localized, but there is a fan patch for PC in the SciADV subreddit discord server here you can join in with this linkdiscord.com/invite/YBmZzfA and follow the instructions to download the first SciADV entry!
Well, I just started, and I'm not hyped by Kai as a main character. For now. I don't see him being superior as Rintaro, but I do remember hating Rintaro at the beginning.
Anyway, I don't feel it is a slow start. It feels faster than Steins;Gate.
Also thanks to you, I understand how Twipo is supposed to work. I was waiting for the game to actively ask me to reply.
Kai is absolutely a slow burn a lot of people might not like, just bear with him and be open minded to how his character subtly starts to develop. He's completely unique to the SciADV main protagonists, and imo his payoff is worth it. Glad I helped you figure out twipo, it does a kinda bad job explaining it :P
7:20 the reason i will keep watching your videos XD also is that a real song i want it
It is! It's part of the R;N DaSH ost, I forget the name but it's there!
@@culIen I found it, both versions and their awesome can't wait for your next video
Bruh DaSH was pure garbage.. I loved R;N although the ending was not complete (aki and kai )but dash was SH!T, id rather play School Days than DaSH
I've gotta admit, I'm still in Phase 2 but MAN the anime did NOT do this game justice. Don't get me wrong, I love the anime still, it's really good IMO but the game explains so much more and it proves why the length is good. It doesn't waste your time, it's actually giving you the perfect amount of everything so you can actually understand the characters, events, and just everything so far.
Talking about how the SG0 anime is better than the VN and saying "we're not ready to have that discussion yet" is also a point I HEAVILY agree on and I have gotten CRAP for it!
Anyway, Robotics;Notes' anime was actually my favorite, even topping Steins;Gate (maybe SG0 tying with it as I like SG0 more than the OG SG) and playing the game just enforces my liking R;N the best.
The only thing I have to mention that I don't like is the marketing of this game... "Heroes don't save the world, otakus do!" That's... that's going to be a meme, and not for nice reasons.......... Honestly..... I think this is one game that can appeal to anyone and everyone yet they have to pander to people who would be considered "anime weirdos" and I really don't think I like it. Didn't like it since the first reveal trailer of Double Pack, and I don't like it still with it being ON THE BACK OF THE GOSH DANG BOOOOOOX! Reminds me of Mighty No. 9's "make the bad guys cry like an anime fan on prom night"... Maybe not as bad but in the same vein... Anyway thanks for the video, and I think I will show this to people who aren't interested in R;N like they were with S;G.
PS: That comment about how it got a T rating... I agree. What the heck? I feel ESRB is weird with ratings sometimes. Also "Frau alone should have made it an M rating" AGREED. 100% AGREED AND I'M JUST GOING OFF THE ANIME AT THIS POINT.
The "holy shit is that translated?" comment about the Tanegashima Map was epic, and btw I think IRUO. is pronounced EE-RU-OH.
Daru in Dash? Okay I don't need any other reason why I should care.
Every time I watch these videos, I happen to be doing dishes
Does it help with the dishes?
*IMPACTO*
wait wait wait robotics notes and steins gate is in same universe?
Hurts me that people dont know this 💔
Chaos Head too
The Chaos; games too
Welp now i got to marathon all of that
@@kusamaID I recommend this order (Release order):
If you know Japanese or Spanish (Spanish for Noah + LCC):
Chaos;Head Noah > Chaos;Head Love Chu Chu! > Steins;Gate (Elite) > Robotics;Notes (Elite) > Chaos;Child > Chaos;Child Love Chu Chu!! > Steins;Gate 0 > Robotics;Notes DaSH
Only English:
Chaos;Head > Steins;Gate (Elite) > Robotics;Notes Elite > Chaos;Child > Steins;Gate 0 > Robotics;Notes DaSH
(Note: All SciADV are different games with different themes, they are not Steins;Gate)
Guess I'm buying another visual novel
Which is the first game in Robotic;Notes? Is ist Elite or dash?
I mention this in the video. Elite is first, DaSH is the sequel.
@@culIen Thank you I added it to my watch later so I still didn't watched it, but I will 👍
I’ve played Chaos;Child but not Chaos;Head, should I hold on Robotics;Notes and finish Chaos;Head, or will I be fine? (I’ve done both Steins;Gate games too)
Nah, my opinion is don't waste time on Chaos;Head where is a matter of time to get the complete edition Chaos;Head NoAH translated. You would need to read again the same once NoAH will come out.
Yeah if you already have C;C you should know enough to be good for R;N
@@4livetv934 Yea but you don't need NoAH exclusive content for R;N or C;C, so original Chaos;Head is enough for both. NoAH fan port will take a year to come out.
so about where would this land in your ranking of the sciadv series?
Its so hard tbh, because before I played it and just watched the anime it was at the bottom. But now I honestly think there is no "bad" mainline entry. C;H, S;G, R;N and C;C are all amazing games with different pros and cons. R;N is just the most consistent in the series imo, so in some ways I kind of think its one of the better games.
What I really hate about Steins;Gate is the system of player choices which is not transparent and ultimately leads to a necessity of reading and following the guide. I recently finished that game, learning later that there is a "true ending" which is accessible by following a series of exact choices hidden behind text-message replies which player has no chance to find in other way than using tedious try/error approach. And now I've learned that Robotics;Notes uses even more complex system of some "online message boards"? Reviewer even says that it's not a shame to follow a guide... It's no good :-(
Its very much worth it to see the true ending of S;G, its a masterpiece in every sense of the word. R;N is actually a lot more simpler than S;G, since once you get all the routes you can just play the true end arc on the menu. All these games have obtuse route systems, but its worth it because the stories are so great.
Robotics;Notes ELITE was amazing! But I just finished DaSH and am very curious to hear what you have to say about it, because I was not impressed...
Edit: It was advertised as a mainline entry, and I guess it technically is, but it's more of a fandisk/side story. So it's best to go in with that mindset
I'm chipping away at it, and will work on my video when I finish :V
Its definitely not as consistent as Elite, but I can see a lot of heart in it so far.
What is the song that plays at 7:20
It's part of the DaSH ost, called the "Tu Ru Tu Ru Dance" I believe
Woah, woah, woah. You NEED to back up that steins;gate 0 claim. Please, my king, how in the world do you find the anime better than the vn? No, im not bitter my favorite scenes were cut out. I want to see Okabe drive and the anime didnt include it so it was infinitly worse!
It for sure cut some, and its not PERFECT, but everything it adds is sooooo good. That ENDING AAAA
@@culIen My opinion on 0 is that the VN is overall better, mostly because of the alternate endings that were cut, but episode 8 and pretty much the whole final arc (except the pretty pathetic fight between Suzuha and the soldiers) is pretty much the best content in the whole franchise.
@@madengineerkyouma yeah that's super valid, I just have some issues with the content in those and feel the execution is messy in the VN. The anime fixed that AWFUL kagari twist, and that was enough for me haha
@DrCullenPHD Yeah, Kagari is one thing the anime improved a lot.
Also, even though I thought he was good in the VN, Daru is Godlike in the anime. Best friend, best dad, best hacker.
What I mostly missed in the anime was Maho's ending, specially what happens to Moeka, since her friendship with Maho was pretty much non-existent in the anime and so was Reyes' involvement in the plot.
Also, I think the Hououin Kyouma revival scene works a bit better with the whole gang together and Suzuha punching Okabe instead of Daru.
Steins series > Robotic series > Chaos series
Ngl I just bought bought this game now
I hope you enjoy your time with them ^-^
this is a really good video, but I would prefer you to not show the line "whose eyes those are" being mentioned in the game, since I wanted to get surprised whenever it comes down to that line.
It shows up in the roughly the first 30 minutes to an hour, and not really again, so I made the call to show it since I wanted to show off the new translation of it. Apologies :(
@@asayakechuurippu7821 whose eyes were those who did not see anything ;)
1:40
Is judo girl as pointless and waste in the visual novel as she was in the anime adaptation?
Nope! Junna gets way more development in the game.
first :)
As someone who's a big fan of slice of life, robotics notes is most definitely not the king of high school slice of life in VNs
I tried playing Steins Gate two times 5 hours it and I thought it was such a slow burn... I Robotics Notes better in that regard?
I think R;N is slower, but the dialogue and writing quality makes the SoL stuff a lot more manageable