@@jamal3100 God rejected after the Israel flesh (i.e. natural born) over 2 thousands years ago because they rejected Jesus Christ. The true children of Abraham consist of people from all ethnic groups worldwide who believe and accept Jesus Christ as their Lord and savior. God is for these people and these people alone.
@Dodger Blue 44 yes we are all from Abraham but the Israelites are gods choosen people. The law wasn’t given to everyone so how can everyone get salvation from just believing in Yahawashi
10As it is written, There is none righteous, no, not one: 11There is none that understandeth, there is none that seeketh after God. 12They are all gone out of the way, they are together become unprofitable; there is none that doeth good, no, not one. 1
A god who has a son? Isn't this a greco-roman pagan idea? Like zeus coming in form of a cloud to Danae (a virgin) and impregnating her with his golden rain?
@@-normal_x4vier-801 Well If People Really Wanted To Get Some Likes, Then They Should Go To Other Video- Where It Can Relate To The Topic Of The video.
I can understand that y’all don’t believe In a Higher Power but to make fun of this video is utterly pathetic. My fellow earthlings are sad humans who can’t respect others for what they believe. Rest assure y’all will regret this one good day . I know y’all can’t see it but it’s coming. May the force be with y’all when this day come . Continue to poke fun if it make you happy . I wish you all the best in life nonetheless.
@@HugowtumGod didn't name the nucleotides, we did. And then the ATGC that are being used are shorter versions of our names for nucleotides. Either someone religious did this to increase religion, or it is a coincidence
@@purp4168 What do you mean? Every atom has a sequence 10-5-6-5 repeating. The corresponding letters are what spell God. The language & numeric system existed before dna was ever discovered. God is outside of time. He knows what will happen before it happens. he’s everywhere simultaneously. coincidences don’t exist, they are just Gods way of remaining unseen. atheists so frequently swear there is no proof. Translation: “no amount of proof would change my mind”. I don’t think atheists care about objective reality, only living a life of self serving desire.
Dayum, kinda sad but remember You don't need anyone but yourself to succeed in life, you're a gigachad that will never fail. (exept cringe and annoying mfs who still plays genshin impact / Gacha life that still dresses as animals)
I like axolotl I like axolotl I like axolotl I like axolotl I like axolotl I like axolotl I like axolotl I like axolotl I like axolotl I like axolotl I like axolotl I like axolotl I like axolotl I like axolotl I like axolotl I like axolotl I like axolotl I like axolotl
I love him and thank him for bring life here and the cute animals and everything else he created but I'm not liking because sorry but u want free likes
Its not hard to know that clearly someone made us,and it's obviously God. As Job 12:7-9 says even the animals know He has created us. But of course non-believers refuse to believe even if they have God right in front of them. So sad. God bless yall ❤️
@@armandojimenez8521 I found you weeb. So explain to me, how did we come to be, and don’t say monkeys with there flicks and bees, why not because it’s a lie, the evolution of monkeys is not a good pose, it was never proven so don’t reply idiotically, do you think you are a fly guy, my guy?
You worship a man! Do you see the problem in question here? Jews and Muslims= Unlimited all powerful G'd who isn't formed of anything Christians= All powerful but limited god who is formed of three persons and is made of flesh and bones. Honestly, if we were to put Yahweh, or Allah vs the trinity, it would be a total disaster for the christian god
I respect christian, muslim, and basically any religion with "unable-to-see" god. I think other religion with "able-to-see" god is dumb, i mean if it like that then it's basically just same thing like human, and god is different than human
I think it is all about encoding and decoding. For example, I can represent A, C, T or G as binary digits, like A is 00, C is 01, T is 10 and G is 11, let me call it ACTG to binary mapping. Then I convert a text I want to represent in ACTG form from Unicode to binary digits and replace these binary digits by ACTG according to mapping I defined earlier. So... YHWH is encoded to CCTCCATACCCGCATA Ragnar is encoded to CCATCTACCTCGCTGTCTACCGAT roro213 is encoded to CGATCTGGCGATCTGGAGATAGACAGAG Of course it depends on text encoding and ACTG to binary mapping, they can use different ones
I assume he is simply looking for clout. However, I believe that DNA is proof of a creator. Because that shit is human control, just as binary is human control of computers.
I hate to be that person but Y, H, and W aren’t letters you find in a sequence of DNA. (Trust me, I’m I biology major) The only letters you can find are A, T, G, and C.
@Danish and Jason scientists don't actually just come how ith names nlmao, they make a decision and sometime sjust made a code name which is later simplified by the public, this isn't about the name it's about the DNA code and the letters
This kind of stuff can discredit Christianity because reasonable people know each nucleic acid, etc is named by people who could look at a common recurring sequence and name it those letters to honor their religion and that this proves nothing but their devotion. To look like all of Christianity is too stupid to see this makes our other beliefs disreputed as well. We shouldn't make a joke out of our beliefs with this.
![[Live] : ONE 169 วันนี้!! "อนาโตลี vs อูมาร์"](http://i.ytimg.com/vi/IK3YZVWuFJg/mqdefault.jpg)
Bible prophecy being fulfilled about fallen angels!!!🤯 WATCH NOW!👇
th-cam.com/users/shortsUdQy5X9UBV8?feature=share
Hey Taylan, god is for the Israelites. Are you an Israelite?
Sorce
I fell like ur lying
@@jamal3100 God rejected after the Israel flesh (i.e. natural born) over 2 thousands years ago because they rejected Jesus Christ. The true children of Abraham consist of people from all ethnic groups worldwide who believe and accept Jesus Christ as their Lord and savior. God is for these people and these people alone.
@@thefox1703 show me in the Bible that the Israelites are no longer gods chosen people.
@Dodger Blue 44 yes we are all from Abraham but the Israelites are gods choosen people. The law wasn’t given to everyone so how can everyone get salvation from just believing in Yahawashi
If you look through any random combination of letters that’s as long as DNA, you’ll find every four letter combination possible
You can find anything if you look hard enough
Fr, this man just found four letters and thinks it god????
So long as it contains G C A and T…
As the saying goes
A 1,000 monkeys would eventually write Shakespeare
bro the nucleic acids in our dna part got me fucked up
99% of comment is asking for like
👇
So are u 😂
So you do 🤣
👁️👄👁️
Who is hungry
👇
I could go for some waffles
Best Night Snack: Cold Pizza🇮🇹
I cooked some spaghetti 🙂👌
I want some eggs but it’s 2 in the morning
Im kinda craving for some curry 🍛
Who Loves God with all their heart, soul, mind, and strength? ✝️
👇🏼
💪🏾💪🏾🙏🏾
There is no good, no not one.
10As it is written, There is none righteous, no, not one: 11There is none that understandeth, there is none that seeketh after God. 12They are all gone out of the way, they are together become unprofitable; there is none that doeth good, no, not one. 1
Who is just randomly scrolling through yt shorts rn?
👇
all coments are like these
All comments are just like
👇
@@melaniezf4n fr
@@BlastTown ik lol i thought id join in
🏹💘 why are all comments like this!
Who likes to breathe
👇
Nah dude I hate to breathe
@@Haydee_Arts 💀
jokes on you, I'm an alien
Ah yes, air. My favorite food
Me
God’s Name in our DNA proves we are His. Now that’s 💗
Who has a father
👇
Not a lot of people
@@clickingz fr prob those gen z's and the weebs 💀
i do
Me to
@@skar6874 that’s factual fr now
Who loves Shrek
👇
I love God more
Green mimkk(っ˘̩╭╮˘̩)っ
I love shrek
Shrek>god
@Poof Ah Diego yes
Who exists
👇
Rip me
God- not me
People who love god
👇❤️❤️
If you didn’t like or share like he told us to
👇
Hi
Bro shut up
Lol 🤣
E
I liked it, it’s about God.
Who Loves SpongeBob SquarePants
👇
Who doesnt
Stop begging for like
Who does?
why is everyone ignoring this video bruh.
Yes, I believe God is real! I know it in my heart, He sent His only begotten Son to save us, Amén. 🙏🏼✝️💕
A god who has a son? Isn't this a greco-roman pagan idea? Like zeus coming in form of a cloud to Danae (a virgin) and impregnating her with his golden rain?
@@Hugowtumwhat the hell are you talking about?
Who touched grass
👇
Damn bro had to give me one I couldn’t like
@@connectionterminated7012 agree with you
Nein vater 🥺🤨
need a brake from Genshin impact?
👇
Who don't want these types of comments
👇
You've become what you wished to destroy...
Me
You became the very thing you swore to destroy
I like them. It shows how many people like chicken nuggets and turtles
Not only does it proves God is real my brother it also proves that God is in all of us.
In the name of Jesus Christ our lord and saviour,
Amen 🙏🏻 ❤❤❤
No it doesn't. This guy has no idea how DNA works or what it is. He's just making sh*t up.
Who likes Rick Astley
👇
You
ME
@@veginya6108 know the
@@pigxiety5479 rules
@@veginya6108 and
agreed that Minecraft better than fortnite
👇
Hell yh bro been playing since 2011, longer than any fortnite players life lmao🤣😏
@@JBlox-xx5bu that's ma boi
It is But prime fortnite was unbeatable
Minecraft waaaaay better
@@HehehehawMonkey prime fortnite vs Minecraft: prime fortnite solos no diff
If your dad is your father
👇
👎🤣🤣🤣
@@rage5277 👍🤣🤣🤣
Mine
I was having doubt that Jehovah exists but this really helps and I hope to strengthen my faith more! Have a good day bye ❤️
Who loves their family?
👇
who believes in giga chad
👇
👍
Wow so funny
@@hampburgerz. not supposed to cause the rest of the comments are like this if you didn't check
People who like turtles
👇
I belong here
@@Furiousbark855 me too i have a stuffed animal turtle called timmy
Master oogway
Me
My pet turtle died
Who thinks ice cream is good?
👇
BISH OFC MEEEE💗💗💗💗💗💗
I’m not calling you a bish by the way💀
Rocky road
Like Beggars, Seriously This Doesn't Even Relate To the Video.
@@reallifetalkingrockman6 and? What’s wrong with that😑
@@-normal_x4vier-801 Well If People Really Wanted To Get Some Likes, Then They Should Go To Other Video- Where It Can Relate To The Topic Of The video.
Who believes birds exist
👇
The are just ur imagination 🙄💅
🤭
@@devilonaxangelika they work for the bozawee
They are spies from the government
They are so cute tho
They are robots
**Every comment be like**
👇
You just copied it
@@daddynoelenjoyer7234 OMG U JUST COPIED WHAT LITERALLY OVER 1K COMMENTS HAVE SAID BEFORE 😱😱 COPUCATATATA
@@raspberryflavoured.druglollies OMG CANXEL HIM°°°°AA!!QA
@@smartboiissmart YES SUE HIM HES BREAKING THE TOS OF TH-cam 😡😡🤬👹
@@daddynoelenjoyer7234 thats the joke
When you realize that the scientists named these sequences themselves🤯🤯🤯
Scientists are priests
@@ragnadrok7 Not all tho
@@ragnadrok7 I guess.
People believe anything if they want it bad enough.
And also to add, we dont even know how to read the human genome lol
facts yahweh is true gods
I Farted
👇
Ayyyyy. Let’s go
That’s nice👌
Finally a comment that I can actually like
@@splawshy3346 shut up
God
Cheeseburgers
👇
Sure
I can use one
Who likes sleeping
👇
random but okay
Me
Wow what a question 😂
Opposite to the topic of a video
I love iy
I can understand that y’all don’t believe In a Higher Power but to make fun of this video is utterly pathetic. My fellow earthlings are sad humans who can’t respect others for what they believe.
Rest assure y’all will regret this one good day .
I know y’all can’t see it but it’s coming. May the force be with y’all when this day come . Continue to poke fun if it make you happy . I wish you all the best in life nonetheless.
God is with me in Jesus name amen
If you believe in floor
👇
Wdym? The floor doesn’t exist. It’s just government drones or something
The floor doesnt exit because it moves in an earthquake
@@henryparker576 exactly
The floor doesn't exit we can only float,get over it😤
@@official.c4t wdym
Who likes ducks
👇
me lmao
Ducks Gor Life.
Ducks are god
YEEEEAAAH BOOOOIII
Ducks shall rule thy world
Hakuna matata
👇
No trouble no double
I was prepared for trouble ,but now Hakuna matata
Ahhahha
Drip goku spitting faxs but i HAV more meme power
Based
I believe it YHVH in the DNA, Thank You Jesus.
@@Thebestbobbyboy alright yeah it's just a coincidence, yeah 😂😂
@@HugowtumGod didn't name the nucleotides, we did. And then the ATGC that are being used are shorter versions of our names for nucleotides. Either someone religious did this to increase religion, or it is a coincidence
@@purp4168 What do you mean? Every atom has a sequence 10-5-6-5 repeating. The corresponding letters are what spell God. The language & numeric system existed before dna was ever discovered. God is outside of time. He knows what will happen before it happens. he’s everywhere simultaneously. coincidences don’t exist, they are just Gods way of remaining unseen. atheists so frequently swear there is no proof. Translation: “no amount of proof would change my mind”. I don’t think atheists care about objective reality, only living a life of self serving desire.
Who is single
👇
100th single here
Dayum, kinda sad
but remember
You don't need anyone but yourself to succeed in life, you're a gigachad that will never fail.
(exept cringe and annoying mfs who still plays genshin impact / Gacha life that still dresses as animals)
Bro i got broke up with today 💀
@@jellyfishing8138 Here comes the A-Train
@@jellyfishing8138 N3rD
Dark Mode users
👇
Who is looking for a comment not asking for likes
👇🏽
Bruh
↑
Muslim here
👇
If you believe in King Bob
👇
Number 88 forever
He is the best
KING BOB!! 👑 🧸
All great artists sign their work
💕
Top Comment
An enormously great parallel. A cogent association worth a much wider audience. Hint , hint
Sooo Correct !!! God bless you !
Thankyou for that, the hairs on my neck stood up when I read that , that actually makes so much scence
If ur gigachad
👇
if you dont like this commment thats prove you are real gigachad who dosent have to verify his chad identity by like
lol
Gigabaijan
Didnt like to keep perfect 200
Wait until they realize letters were made by us😱😱😱
Exactly what i was thinking
it’s almost like humans made up god
@@controversialrooster2940 Ikr
UMGHH HOW? JUST ASKING.
@@reallifetalkingrockman6 we chose what letters to assign each nucleotide.
Who is a Giga Chad
👇
Hello brother
Your not actually gigachad gigachad is a real person
gigachads dont like bait, poser
Giga Chas doesn’t beg for likes
Are capybaras giga chads?
Can all of you guys stop begging for likes?
👇
Bruh😂🤣
I actually laughed in real life 😂. You need more likes
💀💀💀💀 just for that imma like it
I liked it bc of that like what
No
My dog stepped on a bee
👇
You can't see me
God is really here thank you Lord
Who is Muslim
👇
Who like axolotls
👇
What ate axolotls
👇
I like axolotl I like axolotl I like axolotl I like axolotl I like axolotl I like axolotl I like axolotl I like axolotl I like axolotl I like axolotl I like axolotl I like axolotl I like axolotl I like axolotl I like axolotl I like axolotl I like axolotl I like axolotl
im not gay im pan
@@sage-the-silly-0.0 ok?
how did i reply on the wrong comment bro 😭 what kinda yt glitch is this
God is good if think I'm right like dis
👇
Using god for likes?? Do u even believe or just heard his name and use him for likes
@@Real33245 The fog is coming. You will fade into nothing. Your memories, your friends, and your loved ones will be reduced to ash.
@@DOT.Cyber_Funk targeted
Jesus loves us
Hi
👇
Why is that working?
@@obama-gaming4796 thats what i'm thinking
He need brain god
@@obama-gaming4796 I’m just built different
Who likes gaming
👇
Me
Based
Me and who believes in god?
Me and who believes in god?
Man since god created us all i think animals has the god name in their dna too
Who loves God
👇
Yes I love god
W
I love him and thank him for bring life here and the cute animals and everything else he created but I'm not liking because sorry but u want free likes
@@elsthriia Ok I appreciate your comment your opinion if you want like it👌
@@Palat1s :)
When we breathe we say the unspoken name of God. Yah when we inhale Wah when we exhale. Yah-wah
Who believes in quandale dingle
👇
Me
Me because he likes twerkin every time in my backyard to my 12-year-old
Quandale dingle for God 🙏🏻
Not me
I don't believe quandle dingle is god but i do believe he exists :)
Who is a mcdonalds burger
👇
Kumalala kumalala savesta
👇
Quandary dingle here making some vestas..
Idk if it’s the right lyrics pls correct me
Who believes in the flying spaghetti monster
👇
We gotta expand our beliefs
Hail spaghetti monster 🤚
All hail the flying spaghetti monster!! 🙏
ENNARD👁️👄👁️
Yeah hail the " spaghetti master " and go to hell
Who believes these comments are stupid
👇
edit: why do i have so many likes
I believe your comment is stupid 🤓
As emperor palpatine would say
Ironic
Me
Stoepid
How is this many people dumb
If you believe God
👇
Me Amen
Me amen
Me amen
Not me, but still amen I guess.
Everyone who likes this is takin an L
Who breathes
👇
Hi I'm under the water
What’s breathin~
U are God!! And Jesus Christ
Who ate a hamburger in less a year ago
👇
holy this is getting a lot of likes
I'M SOBBING
Who Believe God is Real and loves God
👇
no
bro speak comprehensible english
@@redbirdat1836 same
@@redbirdat1836 nah he real search up hell and witchcraft 🧐
@@Isaac-db4zk idgaf what you believe in but I have a problem with people trying to spread their religion through youtube
who likes turtles 🐢🐢🐢??
👇
Master oogway🤔🤨🐢🐢🐢
Of course i like master oogway 🐢🐢🐢
i have pet common snappibg turtle
Your mom
Master Oogwgay?
I LOVE GOD✝️✝️✝️✝️💗💗💗💗♾️
Who is Christian. Who is not Christian
👇 👇
👍 ✏️
Me I'm Muslim
I’m idk, idk what to believe so I’m idk, religions are all maybes 🤔
👍
👍🙏🏻
✏️
Who likes chicken sandwich
👇
HELL YEAH
@cmations not where I’m going it’s heaven yeah
Why
@@drchicken852 bcuz I’m not going to heaven
Haven't ya
Who Believe Giga Chad
👇
Thank you my son.
Yes
Me
ME
I believe giga Chad but I don’t *believe in him*
Its not hard to know that clearly someone made us,and it's obviously God. As Job 12:7-9 says even the animals know He has created us. But of course non-believers refuse to believe even if they have God right in front of them. So sad. God bless yall ❤️
Who likes doors ?
👇
Nah man I like wheels
Wheels, sorry 😑
Garroth from Aphmau
YESSSIIIRRRRRR
Who trust god
👇
Haha not me suckers!
@Nic Mc sorry to hear that
@@armandojimenez8521 bro what
@Maker Maniac sorry for being able to realize that the way god is described in the Bible doesn't make any sense
@@armandojimenez8521 I found you weeb.
So explain to me, how did we come to be, and don’t say monkeys with there flicks and bees, why not because it’s a lie, the evolution of monkeys is not a good pose, it was never proven so don’t reply idiotically, do you think you are a fly guy, my guy?
Who wants to stop seeing these comments everywhere?
👇
*You became the very thing you swore to destroy.*
Wth
🤣🤣🤣
No, go make more
Omg omg omg omg👍🏻👍🏻👍🏻👍🏻
POV: you're scrolling down the comments just to find a comment that isn't like this
👇
Yes lol.
I'm actually annoyed.
Who likes dogs
👇
Me
Who
I like both cats and dogs
Me
I love god
Who just likes?
👇
me lol
God bless them all in Jesus name 🙏 🙌 ❤️
You worship a man! Do you see the problem in question here?
Jews and Muslims= Unlimited all powerful G'd who isn't formed of anything
Christians= All powerful but limited god who is formed of three persons and is made of flesh and bones.
Honestly, if we were to put Yahweh, or Allah vs the trinity, it would be a total disaster for the christian god
Who believes in God?
👇
If you are not Christian but still respect their beliefs
👇
True beliefs
I respect christian, muslim, and basically any religion with "unable-to-see" god.
I think other religion with "able-to-see" god is dumb, i mean if it like that then it's basically just same thing like human, and god is different than human
"Guys, almost infinitely random sequence of letters had GSJSHSHDHD in it!!! No way!!!!🤯🤯🤯"
man what you typed acaley spell penins
If you exist
👇
Not sure how you can use the letters “A, C, T, G” to spell YHWH.
I think it is all about encoding and decoding. For example, I can represent A, C, T or G as binary digits, like A is 00, C is 01, T is 10 and G is 11, let me call it ACTG to binary mapping. Then I convert a text I want to represent in ACTG form from Unicode to binary digits and replace these binary digits by ACTG according to mapping I defined earlier. So...
YHWH is encoded to CCTCCATACCCGCATA
Ragnar is encoded to CCATCTACCTCGCTGTCTACCGAT
roro213 is encoded to CGATCTGGCGATCTGGAGATAGACAGAG
Of course it depends on text encoding and ACTG to binary mapping, they can use different ones
@@ragnarlaine4065 so what you're saying is that among us is in our DNA somewhere
@@ragnarlaine4065 You probably find Ragnar encoded in our DNA also….
I assume he is simply looking for clout. However, I believe that DNA is proof of a creator. Because that shit is human control, just as binary is human control of computers.
I enjoyed my cheese burger
👇
Cheese burger for life
I hate to be that person but Y, H, and W aren’t letters you find in a sequence of DNA. (Trust me, I’m I biology major)
The only letters you can find are A, T, G, and C.
Who is straight
👇
What
M not
Nah Im bend
Normal*
Who is not gay
Who isnt a girl
👇
69th like
Like beggar
𝙎𝙩𝙤𝙥
Me
Me
If comment section is unoriginal and not funny
👇🏻
wait you did the same thing
r/Woooosh
Somebody did a failed ratio in one of the comments
ANKOU DANCE
You did the same thing too
I found the same in my Alphabet soup.
That’s a good comment. You get a thumbs up 👍
Source: trust me bruh!!
@Danish and Jason scientists don't actually just come how ith names nlmao, they make a decision and sometime sjust made a code name which is later simplified by the public, this isn't about the name it's about the DNA code and the letters
I am groot
👇
Big boi
😅I am groot🔥
Who likes chicken nuggets
👇
ME
ME
Wrong vid bro
@@lloydtbone ur lame
That was random
So I'm With god I'm a bhudist
"Amen" + "Love" + "Peace"
❤️🙏
Who thought they'd find useful comments?
👇
This kind of stuff can discredit Christianity because reasonable people know each nucleic acid, etc is named by people who could look at a common recurring sequence and name it those letters to honor their religion and that this proves nothing but their devotion. To look like all of Christianity is too stupid to see this makes our other beliefs disreputed as well. We shouldn't make a joke out of our beliefs with this.
Who is a Christian
👇🏼
💀💀
Me
@@Icewallocumm 💀💀
@@1_6wk What?
🙏🏻